FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629531_at:

>probe:Drosophila_2:1629531_at:702:71; Interrogation_Position=467; Antisense; AGGCTGATATCGGTGATCTGGCCAA
>probe:Drosophila_2:1629531_at:245:647; Interrogation_Position=606; Antisense; TCAGTTGGGAGGATCCAGTCAGTCC
>probe:Drosophila_2:1629531_at:633:547; Interrogation_Position=613; Antisense; GGAGGATCCAGTCAGTCCCAGAATG
>probe:Drosophila_2:1629531_at:655:545; Interrogation_Position=616; Antisense; GGATCCAGTCAGTCCCAGAATGGAG
>probe:Drosophila_2:1629531_at:640:261; Interrogation_Position=621; Antisense; CAGTCAGTCCCAGAATGGAGGTGTT
>probe:Drosophila_2:1629531_at:653:85; Interrogation_Position=626; Antisense; AGTCCCAGAATGGAGGTGTTGCCTC
>probe:Drosophila_2:1629531_at:416:109; Interrogation_Position=632; Antisense; AGAATGGAGGTGTTGCCTCTACCCT
>probe:Drosophila_2:1629531_at:312:229; Interrogation_Position=634; Antisense; AATGGAGGTGTTGCCTCTACCCTGA
>probe:Drosophila_2:1629531_at:245:589; Interrogation_Position=636; Antisense; TGGAGGTGTTGCCTCTACCCTGAAC
>probe:Drosophila_2:1629531_at:360:81; Interrogation_Position=639; Antisense; AGGTGTTGCCTCTACCCTGAACTTC
>probe:Drosophila_2:1629531_at:23:427; Interrogation_Position=685; Antisense; GAGAGCACCGCTGCCAGTGCTCCAG
>probe:Drosophila_2:1629531_at:275:85; Interrogation_Position=700; Antisense; AGTGCTCCAGGACCAAGCTACCTGC
>probe:Drosophila_2:1629531_at:643:189; Interrogation_Position=730; Antisense; AACATCTTCCGTCGCTTCCGTGTTT
>probe:Drosophila_2:1629531_at:493:271; Interrogation_Position=732; Antisense; CATCTTCCGTCGCTTCCGTGTTTAA

Paste this into a BLAST search page for me
AGGCTGATATCGGTGATCTGGCCAATCAGTTGGGAGGATCCAGTCAGTCCGGAGGATCCAGTCAGTCCCAGAATGGGATCCAGTCAGTCCCAGAATGGAGCAGTCAGTCCCAGAATGGAGGTGTTAGTCCCAGAATGGAGGTGTTGCCTCAGAATGGAGGTGTTGCCTCTACCCTAATGGAGGTGTTGCCTCTACCCTGATGGAGGTGTTGCCTCTACCCTGAACAGGTGTTGCCTCTACCCTGAACTTCGAGAGCACCGCTGCCAGTGCTCCAGAGTGCTCCAGGACCAAGCTACCTGCAACATCTTCCGTCGCTTCCGTGTTTCATCTTCCGTCGCTTCCGTGTTTAA

Full Affymetrix probeset data:

Annotations for 1629531_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720