FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629532_at:

>probe:Drosophila_2:1629532_at:254:57; Interrogation_Position=116; Antisense; ATGAGAAGCGCGTGCGGGCCGCATT
>probe:Drosophila_2:1629532_at:227:475; Interrogation_Position=147; Antisense; GTTACCGTTGAAGAATCTCGGCGAA
>probe:Drosophila_2:1629532_at:430:575; Interrogation_Position=166; Antisense; GGCGAAATTCAGGAAATGACCATCA
>probe:Drosophila_2:1629532_at:392:231; Interrogation_Position=180; Antisense; AATGACCATCAAGTTCTCCGATTCC
>probe:Drosophila_2:1629532_at:560:541; Interrogation_Position=210; Antisense; GGTTGTGGTAATCATGCCCAGGATT
>probe:Drosophila_2:1629532_at:715:29; Interrogation_Position=220; Antisense; ATCATGCCCAGGATTCAGAAAACCA
>probe:Drosophila_2:1629532_at:640:201; Interrogation_Position=240; Antisense; AACCAATCCCAGTTATTTCTTCGTG
>probe:Drosophila_2:1629532_at:221:475; Interrogation_Position=251; Antisense; GTTATTTCTTCGTGATGAGTGGCCA
>probe:Drosophila_2:1629532_at:377:607; Interrogation_Position=263; Antisense; TGATGAGTGGCCATTTCGTGCGCAA
>probe:Drosophila_2:1629532_at:650:579; Interrogation_Position=270; Antisense; TGGCCATTTCGTGCGCAAGTCGTTA
>probe:Drosophila_2:1629532_at:271:273; Interrogation_Position=274; Antisense; CATTTCGTGCGCAAGTCGTTAACAG
>probe:Drosophila_2:1629532_at:13:333; Interrogation_Position=298; Antisense; GCTGGCCCATCCAAAGCACCAAAGG
>probe:Drosophila_2:1629532_at:419:209; Interrogation_Position=88; Antisense; AAGAAAATCCCATCCTTGAATGCGG
>probe:Drosophila_2:1629532_at:91:237; Interrogation_Position=93; Antisense; AATCCCATCCTTGAATGCGGACGAT

Paste this into a BLAST search page for me
ATGAGAAGCGCGTGCGGGCCGCATTGTTACCGTTGAAGAATCTCGGCGAAGGCGAAATTCAGGAAATGACCATCAAATGACCATCAAGTTCTCCGATTCCGGTTGTGGTAATCATGCCCAGGATTATCATGCCCAGGATTCAGAAAACCAAACCAATCCCAGTTATTTCTTCGTGGTTATTTCTTCGTGATGAGTGGCCATGATGAGTGGCCATTTCGTGCGCAATGGCCATTTCGTGCGCAAGTCGTTACATTTCGTGCGCAAGTCGTTAACAGGCTGGCCCATCCAAAGCACCAAAGGAAGAAAATCCCATCCTTGAATGCGGAATCCCATCCTTGAATGCGGACGAT

Full Affymetrix probeset data:

Annotations for 1629532_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720