FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629535_at:

>probe:Drosophila_2:1629535_at:90:309; Interrogation_Position=1000; Antisense; CCAGTGGCTCGAATTGCAGTGCATT
>probe:Drosophila_2:1629535_at:105:495; Interrogation_Position=1054; Antisense; GTCAATTTTAAATCTGCTGCCGCTC
>probe:Drosophila_2:1629535_at:414:39; Interrogation_Position=1065; Antisense; ATCTGCTGCCGCTCTTTTTAAAAAG
>probe:Drosophila_2:1629535_at:36:455; Interrogation_Position=1099; Antisense; GATCAATAGTCAACTCGCGTGCAAG
>probe:Drosophila_2:1629535_at:705:509; Interrogation_Position=1117; Antisense; GTGCAAGCCTCCAATACAGACCATA
>probe:Drosophila_2:1629535_at:186:587; Interrogation_Position=1210; Antisense; TGGACTGACCTTGTATCTACTCAAT
>probe:Drosophila_2:1629535_at:31:143; Interrogation_Position=717; Antisense; ACTGGAGATGCCACAAACCCATTTG
>probe:Drosophila_2:1629535_at:222:713; Interrogation_Position=781; Antisense; TTGGAACGTTTAACCTTCTGCCACG
>probe:Drosophila_2:1629535_at:135:129; Interrogation_Position=803; Antisense; ACGCGCTCCTTATTTACGGAACTGT
>probe:Drosophila_2:1629535_at:636:561; Interrogation_Position=820; Antisense; GGAACTGTTTTGAACCGCTTGGAAT
>probe:Drosophila_2:1629535_at:126:383; Interrogation_Position=871; Antisense; GAACGGCTACGCTTGGCCCGGAGTA
>probe:Drosophila_2:1629535_at:111:27; Interrogation_Position=955; Antisense; ATAGCGATGCAATCGGATCCCTTGC
>probe:Drosophila_2:1629535_at:342:45; Interrogation_Position=971; Antisense; ATCCCTTGCCACCTATTAATTCGGA
>probe:Drosophila_2:1629535_at:308:709; Interrogation_Position=986; Antisense; TTAATTCGGATCAACCAGTGGCTCG

Paste this into a BLAST search page for me
CCAGTGGCTCGAATTGCAGTGCATTGTCAATTTTAAATCTGCTGCCGCTCATCTGCTGCCGCTCTTTTTAAAAAGGATCAATAGTCAACTCGCGTGCAAGGTGCAAGCCTCCAATACAGACCATATGGACTGACCTTGTATCTACTCAATACTGGAGATGCCACAAACCCATTTGTTGGAACGTTTAACCTTCTGCCACGACGCGCTCCTTATTTACGGAACTGTGGAACTGTTTTGAACCGCTTGGAATGAACGGCTACGCTTGGCCCGGAGTAATAGCGATGCAATCGGATCCCTTGCATCCCTTGCCACCTATTAATTCGGATTAATTCGGATCAACCAGTGGCTCG

Full Affymetrix probeset data:

Annotations for 1629535_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720