FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629536_at:

>probe:Drosophila_2:1629536_at:429:667; Interrogation_Position=295; Antisense; TACTTCGTGGGCAGTCTTTCGGATG
>probe:Drosophila_2:1629536_at:415:715; Interrogation_Position=312; Antisense; TTCGGATGTGATGCAACCCACTTTT
>probe:Drosophila_2:1629536_at:454:223; Interrogation_Position=418; Antisense; AAGGTGGAGCTATCTGCGCAGTTGA
>probe:Drosophila_2:1629536_at:691:297; Interrogation_Position=434; Antisense; CGCAGTTGACCACGCAGGATCGGAA
>probe:Drosophila_2:1629536_at:70:185; Interrogation_Position=458; Antisense; AAAAGGTGTGCAGCTGCTCCAGTTC
>probe:Drosophila_2:1629536_at:548:493; Interrogation_Position=505; Antisense; GTCAATCGCCACGTTGAGAGCCGTT
>probe:Drosophila_2:1629536_at:128:523; Interrogation_Position=534; Antisense; GGGCCATTTGGATCAGCCTCGAAAG
>probe:Drosophila_2:1629536_at:423:175; Interrogation_Position=563; Antisense; AAACCGTGTGTCATGGGAGGCAATC
>probe:Drosophila_2:1629536_at:674:707; Interrogation_Position=691; Antisense; TTAAGTAGCCTTAGCCAGAGTTCCT
>probe:Drosophila_2:1629536_at:299:101; Interrogation_Position=707; Antisense; AGAGTTCCTCGCTGACGCAGTGCAG
>probe:Drosophila_2:1629536_at:561:309; Interrogation_Position=740; Antisense; CCAGCTGTAGTTCTCCTTTGGATGA
>probe:Drosophila_2:1629536_at:305:547; Interrogation_Position=759; Antisense; GGATGAGCATCACAACAGCTGCGAT
>probe:Drosophila_2:1629536_at:348:119; Interrogation_Position=775; Antisense; AGCTGCGATATATGCCAGGCCTACA
>probe:Drosophila_2:1629536_at:570:667; Interrogation_Position=796; Antisense; TACAGGCGCATGTTTCCTTCTTACT

Paste this into a BLAST search page for me
TACTTCGTGGGCAGTCTTTCGGATGTTCGGATGTGATGCAACCCACTTTTAAGGTGGAGCTATCTGCGCAGTTGACGCAGTTGACCACGCAGGATCGGAAAAAAGGTGTGCAGCTGCTCCAGTTCGTCAATCGCCACGTTGAGAGCCGTTGGGCCATTTGGATCAGCCTCGAAAGAAACCGTGTGTCATGGGAGGCAATCTTAAGTAGCCTTAGCCAGAGTTCCTAGAGTTCCTCGCTGACGCAGTGCAGCCAGCTGTAGTTCTCCTTTGGATGAGGATGAGCATCACAACAGCTGCGATAGCTGCGATATATGCCAGGCCTACATACAGGCGCATGTTTCCTTCTTACT

Full Affymetrix probeset data:

Annotations for 1629536_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720