Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629538_s_at:

>probe:Drosophila_2:1629538_s_at:662:217; Interrogation_Position=100; Antisense; AAGTATCTAGTTGGCTGCGTGGTCC
>probe:Drosophila_2:1629538_s_at:588:581; Interrogation_Position=119; Antisense; TGGTCCGGGTCTGCAACGAGTTGTC
>probe:Drosophila_2:1629538_s_at:388:245; Interrogation_Position=13; Antisense; CAATTTGGTTCTAAGTCTCGTCGCG
>probe:Drosophila_2:1629538_s_at:168:293; Interrogation_Position=135; Antisense; CGAGTTGTCCCAGAACATGAGTTCA
>probe:Drosophila_2:1629538_s_at:69:231; Interrogation_Position=168; Antisense; AATGTTCAAGTACCATTTGCTGGAG
>probe:Drosophila_2:1629538_s_at:65:723; Interrogation_Position=184; Antisense; TTGCTGGAGGTTAGCTAGAGGTCCC
>probe:Drosophila_2:1629538_s_at:66:419; Interrogation_Position=217; Antisense; GAGCTAAATACCCTTACTGATTAGA
>probe:Drosophila_2:1629538_s_at:514:701; Interrogation_Position=250; Antisense; TTTTCGCCTGTCGAACAAGTTCGTT
>probe:Drosophila_2:1629538_s_at:710:91; Interrogation_Position=267; Antisense; AGTTCGTTGCTCAAGTCTTTCGTTA
>probe:Drosophila_2:1629538_s_at:478:475; Interrogation_Position=27; Antisense; GTCTCGTCGCGTGTGCATGAAGGCA
>probe:Drosophila_2:1629538_s_at:113:31; Interrogation_Position=301; Antisense; ATAAAGCGTATTTCATCCATCCAAA
>probe:Drosophila_2:1629538_s_at:532:371; Interrogation_Position=45; Antisense; GAAGGCAGTTCTTTGAGTTCTCGAC
>probe:Drosophila_2:1629538_s_at:294:93; Interrogation_Position=60; Antisense; AGTTCTCGACTTTATCGCCATGGTG
>probe:Drosophila_2:1629538_s_at:599:307; Interrogation_Position=77; Antisense; CCATGGTGCTGCTGCGAGTGATCAA

Paste this into a BLAST search page for me
AAGTATCTAGTTGGCTGCGTGGTCCTGGTCCGGGTCTGCAACGAGTTGTCCAATTTGGTTCTAAGTCTCGTCGCGCGAGTTGTCCCAGAACATGAGTTCAAATGTTCAAGTACCATTTGCTGGAGTTGCTGGAGGTTAGCTAGAGGTCCCGAGCTAAATACCCTTACTGATTAGATTTTCGCCTGTCGAACAAGTTCGTTAGTTCGTTGCTCAAGTCTTTCGTTAGTCTCGTCGCGTGTGCATGAAGGCAATAAAGCGTATTTCATCCATCCAAAGAAGGCAGTTCTTTGAGTTCTCGACAGTTCTCGACTTTATCGCCATGGTGCCATGGTGCTGCTGCGAGTGATCAA

Full Affymetrix probeset data:

Annotations for 1629538_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime