Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629539_s_at:

>probe:Drosophila_2:1629539_s_at:214:109; Interrogation_Position=257; Antisense; AGAAGCGCAGCCAGAAGCGTCGCAT
>probe:Drosophila_2:1629539_s_at:58:441; Interrogation_Position=322; Antisense; GAGGCCTGTCGATTTTGTGCTCACA
>probe:Drosophila_2:1629539_s_at:179:693; Interrogation_Position=335; Antisense; TTTGTGCTCACAGTCCGCAGGGCTA
>probe:Drosophila_2:1629539_s_at:520:605; Interrogation_Position=420; Antisense; TGAGCAGGATTTCCGGCAGATTCGC
>probe:Drosophila_2:1629539_s_at:181:95; Interrogation_Position=437; Antisense; AGATTCGCCGAATCAAGCGGGAGCT
>probe:Drosophila_2:1629539_s_at:544:663; Interrogation_Position=461; Antisense; TAAAGCGGACTCTTGGCCAGCAGCA
>probe:Drosophila_2:1629539_s_at:32:115; Interrogation_Position=485; Antisense; AGCAGCAACTGCAACCGACGAGAAG
>probe:Drosophila_2:1629539_s_at:4:109; Interrogation_Position=505; Antisense; AGAAGCTATCGTCCAGTCCGACTGA
>probe:Drosophila_2:1629539_s_at:320:121; Interrogation_Position=535; Antisense; AGCTGGAGCAGCAGTTCCCTGAGCA
>probe:Drosophila_2:1629539_s_at:495:717; Interrogation_Position=549; Antisense; TTCCCTGAGCAGTGGTTACGCTTCA
>probe:Drosophila_2:1629539_s_at:224:673; Interrogation_Position=565; Antisense; TACGCTTCACTGACCAGCGTTGGAT
>probe:Drosophila_2:1629539_s_at:423:77; Interrogation_Position=602; Antisense; AGGAGGCGTCCTTCGATCAGGATAT
>probe:Drosophila_2:1629539_s_at:47:691; Interrogation_Position=627; Antisense; TATTGAGGACGTTCCACTGGAGGAG
>probe:Drosophila_2:1629539_s_at:322:349; Interrogation_Position=675; Antisense; GCAGGAGGATATCCAACAGCCCCTA

Paste this into a BLAST search page for me
AGAAGCGCAGCCAGAAGCGTCGCATGAGGCCTGTCGATTTTGTGCTCACATTTGTGCTCACAGTCCGCAGGGCTATGAGCAGGATTTCCGGCAGATTCGCAGATTCGCCGAATCAAGCGGGAGCTTAAAGCGGACTCTTGGCCAGCAGCAAGCAGCAACTGCAACCGACGAGAAGAGAAGCTATCGTCCAGTCCGACTGAAGCTGGAGCAGCAGTTCCCTGAGCATTCCCTGAGCAGTGGTTACGCTTCATACGCTTCACTGACCAGCGTTGGATAGGAGGCGTCCTTCGATCAGGATATTATTGAGGACGTTCCACTGGAGGAGGCAGGAGGATATCCAACAGCCCCTA

Full Affymetrix probeset data:

Annotations for 1629539_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime