FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629541_at:

>probe:Drosophila_2:1629541_at:75:325; Interrogation_Position=101; Antisense; GCGACTGCTGCAAAATGGGCAAAAC
>probe:Drosophila_2:1629541_at:251:169; Interrogation_Position=113; Antisense; AAATGGGCAAAACGCCGCGCCAGTG
>probe:Drosophila_2:1629541_at:696:57; Interrogation_Position=13; Antisense; ATGATGCGCTACGAGGGCAACGAGA
>probe:Drosophila_2:1629541_at:661:313; Interrogation_Position=131; Antisense; GCCAGTGCCTCCAGGACAACAACGT
>probe:Drosophila_2:1629541_at:12:75; Interrogation_Position=143; Antisense; AGGACAACAACGTTCCAGCTGAGTG
>probe:Drosophila_2:1629541_at:352:119; Interrogation_Position=159; Antisense; AGCTGAGTGCCAGGTGCTCCGCAAT
>probe:Drosophila_2:1629541_at:394:619; Interrogation_Position=173; Antisense; TGCTCCGCAATACCTTCTACGAGTG
>probe:Drosophila_2:1629541_at:473:249; Interrogation_Position=180; Antisense; CAATACCTTCTACGAGTGCAAGCGC
>probe:Drosophila_2:1629541_at:343:85; Interrogation_Position=194; Antisense; AGTGCAAGCGCTCCCTGTTGGACAA
>probe:Drosophila_2:1629541_at:307:465; Interrogation_Position=210; Antisense; GTTGGACAACCGACAGCGCTTTCGA
>probe:Drosophila_2:1629541_at:359:123; Interrogation_Position=224; Antisense; AGCGCTTTCGAGGTCGCAAGGGCTA
>probe:Drosophila_2:1629541_at:450:273; Interrogation_Position=228; Antisense; CTTTCGAGGTCGCAAGGGCTACTGA
>probe:Drosophila_2:1629541_at:4:91; Interrogation_Position=66; Antisense; AGTACGTGCGGATCTCAAGATGTGC
>probe:Drosophila_2:1629541_at:345:215; Interrogation_Position=82; Antisense; AAGATGTGCCTCCTGGAGAGCGACT

Paste this into a BLAST search page for me
GCGACTGCTGCAAAATGGGCAAAACAAATGGGCAAAACGCCGCGCCAGTGATGATGCGCTACGAGGGCAACGAGAGCCAGTGCCTCCAGGACAACAACGTAGGACAACAACGTTCCAGCTGAGTGAGCTGAGTGCCAGGTGCTCCGCAATTGCTCCGCAATACCTTCTACGAGTGCAATACCTTCTACGAGTGCAAGCGCAGTGCAAGCGCTCCCTGTTGGACAAGTTGGACAACCGACAGCGCTTTCGAAGCGCTTTCGAGGTCGCAAGGGCTACTTTCGAGGTCGCAAGGGCTACTGAAGTACGTGCGGATCTCAAGATGTGCAAGATGTGCCTCCTGGAGAGCGACT

Full Affymetrix probeset data:

Annotations for 1629541_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720