Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629542_at:

>probe:Drosophila_2:1629542_at:615:465; Interrogation_Position=1038; Antisense; GTTGGACACTTTAGTGCCGACCACA
>probe:Drosophila_2:1629542_at:578:723; Interrogation_Position=1069; Antisense; TTGGCTCTGATCAAGGACTGGGCAT
>probe:Drosophila_2:1629542_at:350:69; Interrogation_Position=1118; Antisense; AGGCCAATCGCACAACCATAGTTAT
>probe:Drosophila_2:1629542_at:276:501; Interrogation_Position=1171; Antisense; GTCGGAGGCAACTTCGGGATGTACT
>probe:Drosophila_2:1629542_at:421:663; Interrogation_Position=1192; Antisense; TACTGGATAAATCGGTCGGGCCACA
>probe:Drosophila_2:1629542_at:276:97; Interrogation_Position=1227; Antisense; AGATAATCCAGTCGCCATGCAGTAT
>probe:Drosophila_2:1629542_at:147:53; Interrogation_Position=1243; Antisense; ATGCAGTATGTCCTTCAATCCGTTA
>probe:Drosophila_2:1629542_at:658:103; Interrogation_Position=809; Antisense; AGACCCACGTGGATCCTTCAGAGGA
>probe:Drosophila_2:1629542_at:218:85; Interrogation_Position=886; Antisense; AGTGAGGCCCTGCAGATCAATGGTA
>probe:Drosophila_2:1629542_at:368:33; Interrogation_Position=901; Antisense; ATCAATGGTACTGTCTATGCGTCAC
>probe:Drosophila_2:1629542_at:575:65; Interrogation_Position=931; Antisense; ATGGAAGTGTTGTCCAGCCTTCACG
>probe:Drosophila_2:1629542_at:642:125; Interrogation_Position=946; Antisense; AGCCTTCACGGAGATCGCCTGAAAT
>probe:Drosophila_2:1629542_at:31:397; Interrogation_Position=973; Antisense; GAAATTAATACAATCCCGCGCCTGC
>probe:Drosophila_2:1629542_at:405:323; Interrogation_Position=990; Antisense; GCGCCTGCTGAATGAGACCTCTGTT

Paste this into a BLAST search page for me
GTTGGACACTTTAGTGCCGACCACATTGGCTCTGATCAAGGACTGGGCATAGGCCAATCGCACAACCATAGTTATGTCGGAGGCAACTTCGGGATGTACTTACTGGATAAATCGGTCGGGCCACAAGATAATCCAGTCGCCATGCAGTATATGCAGTATGTCCTTCAATCCGTTAAGACCCACGTGGATCCTTCAGAGGAAGTGAGGCCCTGCAGATCAATGGTAATCAATGGTACTGTCTATGCGTCACATGGAAGTGTTGTCCAGCCTTCACGAGCCTTCACGGAGATCGCCTGAAATGAAATTAATACAATCCCGCGCCTGCGCGCCTGCTGAATGAGACCTCTGTT

Full Affymetrix probeset data:

Annotations for 1629542_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime