Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629545_at:

>probe:Drosophila_2:1629545_at:235:377; Interrogation_Position=1330; Antisense; GAAGCAGAGCAGCTACCACGGTGTC
>probe:Drosophila_2:1629545_at:424:187; Interrogation_Position=1367; Antisense; AACACCAACCAGGACAGCAAGGACT
>probe:Drosophila_2:1629545_at:292:547; Interrogation_Position=1400; Antisense; GGATGAGTCTGCTTACTCTGGACAC
>probe:Drosophila_2:1629545_at:590:281; Interrogation_Position=1415; Antisense; CTCTGGACACCTGGAATGGCAACTA
>probe:Drosophila_2:1629545_at:643:139; Interrogation_Position=1461; Antisense; AACCACACAAACACTGTAGTCCCTA
>probe:Drosophila_2:1629545_at:372:275; Interrogation_Position=1474; Antisense; CTGTAGTCCCTAAGTTGAACCCATA
>probe:Drosophila_2:1629545_at:143:467; Interrogation_Position=1487; Antisense; GTTGAACCCATATTGGCCCTTTTCT
>probe:Drosophila_2:1629545_at:633:581; Interrogation_Position=1500; Antisense; TGGCCCTTTTCTTGAGATTACCTAA
>probe:Drosophila_2:1629545_at:437:421; Interrogation_Position=1534; Antisense; GAGCACATCGCGAAATTCAGCAAAT
>probe:Drosophila_2:1629545_at:182:511; Interrogation_Position=1717; Antisense; GTGTTTTTGTGGTGTTGAGGTCTAA
>probe:Drosophila_2:1629545_at:496:607; Interrogation_Position=1732; Antisense; TGAGGTCTAATCTTCTCCACTTATG
>probe:Drosophila_2:1629545_at:284:629; Interrogation_Position=1747; Antisense; TCCACTTATGGCTTGGGCTCAGATT
>probe:Drosophila_2:1629545_at:660:7; Interrogation_Position=1807; Antisense; ATTGCTCATGGGAGGCTGGCGTTAT
>probe:Drosophila_2:1629545_at:157:311; Interrogation_Position=1874; Antisense; GCCAAGAGTTTAGGATCAGGGCTTA

Paste this into a BLAST search page for me
GAAGCAGAGCAGCTACCACGGTGTCAACACCAACCAGGACAGCAAGGACTGGATGAGTCTGCTTACTCTGGACACCTCTGGACACCTGGAATGGCAACTAAACCACACAAACACTGTAGTCCCTACTGTAGTCCCTAAGTTGAACCCATAGTTGAACCCATATTGGCCCTTTTCTTGGCCCTTTTCTTGAGATTACCTAAGAGCACATCGCGAAATTCAGCAAATGTGTTTTTGTGGTGTTGAGGTCTAATGAGGTCTAATCTTCTCCACTTATGTCCACTTATGGCTTGGGCTCAGATTATTGCTCATGGGAGGCTGGCGTTATGCCAAGAGTTTAGGATCAGGGCTTA

Full Affymetrix probeset data:

Annotations for 1629545_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime