FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629547_at:

>probe:Drosophila_2:1629547_at:100:399; Interrogation_Position=389; Antisense; GACACCAAGCGGGAATTCTCCTGTA
>probe:Drosophila_2:1629547_at:136:241; Interrogation_Position=418; Antisense; AATACAGGACATGCTTCGGGCCAGG
>probe:Drosophila_2:1629547_at:156:269; Interrogation_Position=494; Antisense; CAGGCTGCCACTGGTGCTGATATAA
>probe:Drosophila_2:1629547_at:595:609; Interrogation_Position=549; Antisense; TGACCGCTGAAACACATGCTTCCAT
>probe:Drosophila_2:1629547_at:665:93; Interrogation_Position=582; Antisense; AGTTGGTCCTTATTGATTCGCTTGC
>probe:Drosophila_2:1629547_at:456:215; Interrogation_Position=680; Antisense; AAGATCCGGAAACTAGCTCTCAGGG
>probe:Drosophila_2:1629547_at:248:575; Interrogation_Position=704; Antisense; GGCGTGGCTTTTGTCATTGGGAATA
>probe:Drosophila_2:1629547_at:377:399; Interrogation_Position=774; Antisense; GACACGACAGCAGTTGGAGCCCATG
>probe:Drosophila_2:1629547_at:519:59; Interrogation_Position=796; Antisense; ATGTTGGGATCCTACTGGAGCTCGG
>probe:Drosophila_2:1629547_at:170:649; Interrogation_Position=830; Antisense; TCAGATTGTCGGTGGAGCTTCCAGA
>probe:Drosophila_2:1629547_at:194:439; Interrogation_Position=853; Antisense; GAGGAAGAGGACTTCACCCTCCAGG
>probe:Drosophila_2:1629547_at:86:69; Interrogation_Position=881; Antisense; ATGGCCTGCGTTTCATTTACGTCAT
>probe:Drosophila_2:1629547_at:410:497; Interrogation_Position=901; Antisense; GTCATCTCGAACACATATGGCCCTG
>probe:Drosophila_2:1629547_at:350:679; Interrogation_Position=916; Antisense; TATGGCCCTGATGGTGAGCACTGTC

Paste this into a BLAST search page for me
GACACCAAGCGGGAATTCTCCTGTAAATACAGGACATGCTTCGGGCCAGGCAGGCTGCCACTGGTGCTGATATAATGACCGCTGAAACACATGCTTCCATAGTTGGTCCTTATTGATTCGCTTGCAAGATCCGGAAACTAGCTCTCAGGGGGCGTGGCTTTTGTCATTGGGAATAGACACGACAGCAGTTGGAGCCCATGATGTTGGGATCCTACTGGAGCTCGGTCAGATTGTCGGTGGAGCTTCCAGAGAGGAAGAGGACTTCACCCTCCAGGATGGCCTGCGTTTCATTTACGTCATGTCATCTCGAACACATATGGCCCTGTATGGCCCTGATGGTGAGCACTGTC

Full Affymetrix probeset data:

Annotations for 1629547_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720