Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629549_s_at:

>probe:Drosophila_2:1629549_s_at:284:223; Interrogation_Position=128; Antisense; AAGGATACACCAAATCTATAGACAT
>probe:Drosophila_2:1629549_s_at:255:677; Interrogation_Position=146; Antisense; TAGACATATGGTCCGTTGGCTGCAT
>probe:Drosophila_2:1629549_s_at:80:335; Interrogation_Position=175; Antisense; GCTGAAATGTTAAGTAATCGGCCAA
>probe:Drosophila_2:1629549_s_at:323:385; Interrogation_Position=308; Antisense; GAACTATTTGGAATCTTTACCATTT
>probe:Drosophila_2:1629549_s_at:21:637; Interrogation_Position=33; Antisense; TCGTATTGCAGATCCCGAGCACGAT
>probe:Drosophila_2:1629549_s_at:727:299; Interrogation_Position=345; Antisense; CCCTGGGCGAAACTATTTCCAAATG
>probe:Drosophila_2:1629549_s_at:545:147; Interrogation_Position=356; Antisense; ACTATTTCCAAATGCTGATGCGTTG
>probe:Drosophila_2:1629549_s_at:281:605; Interrogation_Position=371; Antisense; TGATGCGTTGGCTTTAGATCTCCTT
>probe:Drosophila_2:1629549_s_at:679:695; Interrogation_Position=411; Antisense; TTTAACCCGCATAAACGGATTCCTG
>probe:Drosophila_2:1629549_s_at:414:141; Interrogation_Position=425; Antisense; ACGGATTCCTGTCGAGGAAGCTCTT
>probe:Drosophila_2:1629549_s_at:171:421; Interrogation_Position=49; Antisense; GAGCACGATCATACTGGCTTTCTCA
>probe:Drosophila_2:1629549_s_at:250:29; Interrogation_Position=59; Antisense; ATACTGGCTTTCTCACAGAATACGT
>probe:Drosophila_2:1629549_s_at:131:263; Interrogation_Position=74; Antisense; CAGAATACGTTGCTACCCGATGGTA
>probe:Drosophila_2:1629549_s_at:230:673; Interrogation_Position=87; Antisense; TACCCGATGGTATAGAGCACCTGAA

Paste this into a BLAST search page for me
AAGGATACACCAAATCTATAGACATTAGACATATGGTCCGTTGGCTGCATGCTGAAATGTTAAGTAATCGGCCAAGAACTATTTGGAATCTTTACCATTTTCGTATTGCAGATCCCGAGCACGATCCCTGGGCGAAACTATTTCCAAATGACTATTTCCAAATGCTGATGCGTTGTGATGCGTTGGCTTTAGATCTCCTTTTTAACCCGCATAAACGGATTCCTGACGGATTCCTGTCGAGGAAGCTCTTGAGCACGATCATACTGGCTTTCTCAATACTGGCTTTCTCACAGAATACGTCAGAATACGTTGCTACCCGATGGTATACCCGATGGTATAGAGCACCTGAA

Full Affymetrix probeset data:

Annotations for 1629549_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime