Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629550_at:

>probe:Drosophila_2:1629550_at:417:325; Interrogation_Position=3067; Antisense; GCGAGGCTACATTGCATGAGTTCTT
>probe:Drosophila_2:1629550_at:189:559; Interrogation_Position=3092; Antisense; GGACAACTTGTACAGCGGACAGCAT
>probe:Drosophila_2:1629550_at:253:577; Interrogation_Position=3122; Antisense; GGCGCACAACGCCTTTGCAGGAAAT
>probe:Drosophila_2:1629550_at:271:73; Interrogation_Position=3140; Antisense; AGGAAATGCTCGTCGTCGAACGCGA
>probe:Drosophila_2:1629550_at:414:381; Interrogation_Position=3157; Antisense; GAACGCGACGTAACTAAGCCTCACG
>probe:Drosophila_2:1629550_at:588:203; Interrogation_Position=3172; Antisense; AAGCCTCACGGTCATAGTCTTAAGT
>probe:Drosophila_2:1629550_at:32:685; Interrogation_Position=3221; Antisense; TATAATCTACCCAATGTGTCGCCGT
>probe:Drosophila_2:1629550_at:472:603; Interrogation_Position=3250; Antisense; TGATTGGCCTTAACTCACTTCCAAG
>probe:Drosophila_2:1629550_at:95:263; Interrogation_Position=3333; Antisense; CAGCGCCCGAAGTTGTATGTTTTTT
>probe:Drosophila_2:1629550_at:415:579; Interrogation_Position=3366; Antisense; GGCCATATCAACTCTTGGAGCTGGT
>probe:Drosophila_2:1629550_at:215:185; Interrogation_Position=3431; Antisense; AAAATTGCCTTCCACTACATCTATG
>probe:Drosophila_2:1629550_at:703:653; Interrogation_Position=3459; Antisense; TAATATTTTGTTTTTGCTCCCTCTT
>probe:Drosophila_2:1629550_at:387:313; Interrogation_Position=3489; Antisense; GCCAGCTTGTCACACGTAGTTCTTA
>probe:Drosophila_2:1629550_at:130:209; Interrogation_Position=3563; Antisense; AAGCAAATGCGACGGCACACGTTTA

Paste this into a BLAST search page for me
GCGAGGCTACATTGCATGAGTTCTTGGACAACTTGTACAGCGGACAGCATGGCGCACAACGCCTTTGCAGGAAATAGGAAATGCTCGTCGTCGAACGCGAGAACGCGACGTAACTAAGCCTCACGAAGCCTCACGGTCATAGTCTTAAGTTATAATCTACCCAATGTGTCGCCGTTGATTGGCCTTAACTCACTTCCAAGCAGCGCCCGAAGTTGTATGTTTTTTGGCCATATCAACTCTTGGAGCTGGTAAAATTGCCTTCCACTACATCTATGTAATATTTTGTTTTTGCTCCCTCTTGCCAGCTTGTCACACGTAGTTCTTAAAGCAAATGCGACGGCACACGTTTA

Full Affymetrix probeset data:

Annotations for 1629550_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime