FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629552_at:

>probe:Drosophila_2:1629552_at:391:67; Interrogation_Position=1002; Antisense; AGGCCTCGCGGCAAGCTTAAAAAGT
>probe:Drosophila_2:1629552_at:186:727; Interrogation_Position=1090; Antisense; TTGTCTATGCATTTCTATGGTCCAA
>probe:Drosophila_2:1629552_at:284:681; Interrogation_Position=1105; Antisense; TATGGTCCAAAGAAGCTCAGAGCTC
>probe:Drosophila_2:1629552_at:236:103; Interrogation_Position=1123; Antisense; AGAGCTCTAGTAACTGCCTGCAGCG
>probe:Drosophila_2:1629552_at:66:283; Interrogation_Position=1136; Antisense; CTGCCTGCAGCGTTTAAAAGTACAA
>probe:Drosophila_2:1629552_at:447:491; Interrogation_Position=1155; Antisense; GTACAATGCACAAGCACCTAGCTGG
>probe:Drosophila_2:1629552_at:82:455; Interrogation_Position=1211; Antisense; GATCACGCAATTTTTTAGTCAAACT
>probe:Drosophila_2:1629552_at:726:275; Interrogation_Position=1234; Antisense; CTTATAAGCGTTACACAGACATCCT
>probe:Drosophila_2:1629552_at:575:401; Interrogation_Position=1251; Antisense; GACATCCTAGTGAACGGTTTGCGTT
>probe:Drosophila_2:1629552_at:454:55; Interrogation_Position=809; Antisense; ATGACCCTGGAGGATGTTCGCGCCT
>probe:Drosophila_2:1629552_at:544:59; Interrogation_Position=822; Antisense; ATGTTCGCGCCTACGAGCGTCAAAA
>probe:Drosophila_2:1629552_at:177:463; Interrogation_Position=868; Antisense; GATTCACAACACAAGTGGTGGCGCA
>probe:Drosophila_2:1629552_at:289:593; Interrogation_Position=883; Antisense; TGGTGGCGCAAATGCAGCGGCCAAC
>probe:Drosophila_2:1629552_at:105:161; Interrogation_Position=988; Antisense; AAATAGTACCTTCAAGGCCTCGCGG

Paste this into a BLAST search page for me
AGGCCTCGCGGCAAGCTTAAAAAGTTTGTCTATGCATTTCTATGGTCCAATATGGTCCAAAGAAGCTCAGAGCTCAGAGCTCTAGTAACTGCCTGCAGCGCTGCCTGCAGCGTTTAAAAGTACAAGTACAATGCACAAGCACCTAGCTGGGATCACGCAATTTTTTAGTCAAACTCTTATAAGCGTTACACAGACATCCTGACATCCTAGTGAACGGTTTGCGTTATGACCCTGGAGGATGTTCGCGCCTATGTTCGCGCCTACGAGCGTCAAAAGATTCACAACACAAGTGGTGGCGCATGGTGGCGCAAATGCAGCGGCCAACAAATAGTACCTTCAAGGCCTCGCGG

Full Affymetrix probeset data:

Annotations for 1629552_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720