FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629553_at:

>probe:Drosophila_2:1629553_at:44:655; Interrogation_Position=439; Antisense; TCAATCTCAAATTCCACCTCAACTT
>probe:Drosophila_2:1629553_at:4:653; Interrogation_Position=457; Antisense; TCAACTTCAGCCATATCCACAAAGG
>probe:Drosophila_2:1629553_at:110:163; Interrogation_Position=534; Antisense; AAATTGGCGGCAGTCGCTCATTGGC
>probe:Drosophila_2:1629553_at:534:421; Interrogation_Position=593; Antisense; GAGAATTTCTATGAACCCGCTCAGC
>probe:Drosophila_2:1629553_at:594:327; Interrogation_Position=625; Antisense; GCGTCGTGATTACCAGGCCAAATAT
>probe:Drosophila_2:1629553_at:171:163; Interrogation_Position=644; Antisense; AAATATGCCCAACATTTTGCCGAAT
>probe:Drosophila_2:1629553_at:141:491; Interrogation_Position=675; Antisense; GTAAATATCCAAGACGCCTGCAGCC
>probe:Drosophila_2:1629553_at:417:353; Interrogation_Position=694; Antisense; GCAGCCAGTTTACAACACCAACGAG
>probe:Drosophila_2:1629553_at:7:167; Interrogation_Position=781; Antisense; AAATCCCCTCAAGAGCCATTAGCAA
>probe:Drosophila_2:1629553_at:676:355; Interrogation_Position=802; Antisense; GCAATTTTCGTTGAAAGCGTGCCAA
>probe:Drosophila_2:1629553_at:356:179; Interrogation_Position=828; Antisense; AAAACTATTTCTGTCTGTACTCGGA
>probe:Drosophila_2:1629553_at:314:561; Interrogation_Position=850; Antisense; GGAACAGATCAATTGCATCCGATAA
>probe:Drosophila_2:1629553_at:286:623; Interrogation_Position=884; Antisense; TTGCAGCTGCTGTAGAGTCAACATG
>probe:Drosophila_2:1629553_at:495:431; Interrogation_Position=898; Antisense; GAGTCAACATGCCAACACAGTAAAT

Paste this into a BLAST search page for me
TCAATCTCAAATTCCACCTCAACTTTCAACTTCAGCCATATCCACAAAGGAAATTGGCGGCAGTCGCTCATTGGCGAGAATTTCTATGAACCCGCTCAGCGCGTCGTGATTACCAGGCCAAATATAAATATGCCCAACATTTTGCCGAATGTAAATATCCAAGACGCCTGCAGCCGCAGCCAGTTTACAACACCAACGAGAAATCCCCTCAAGAGCCATTAGCAAGCAATTTTCGTTGAAAGCGTGCCAAAAAACTATTTCTGTCTGTACTCGGAGGAACAGATCAATTGCATCCGATAATTGCAGCTGCTGTAGAGTCAACATGGAGTCAACATGCCAACACAGTAAAT

Full Affymetrix probeset data:

Annotations for 1629553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720