Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629554_at:

>probe:Drosophila_2:1629554_at:118:497; Interrogation_Position=1262; Antisense; GTCAGCTGTTTCAGGATGCCATGAA
>probe:Drosophila_2:1629554_at:59:211; Interrogation_Position=1285; Antisense; AAGCAAGAGCCCGTAGCTGTGGCCA
>probe:Drosophila_2:1629554_at:330:431; Interrogation_Position=1322; Antisense; GAGTAAATGCCTGTCCCGTGAAGGA
>probe:Drosophila_2:1629554_at:668:521; Interrogation_Position=1354; Antisense; GTGGCTCCCTTTTGGGCAAACAATA
>probe:Drosophila_2:1629554_at:400:373; Interrogation_Position=1440; Antisense; GAAGTGCACCCACGAGTTCAAGCAA
>probe:Drosophila_2:1629554_at:435:473; Interrogation_Position=1455; Antisense; GTTCAAGCAAATGTTCTGCCGCGAT
>probe:Drosophila_2:1629554_at:499:99; Interrogation_Position=1486; Antisense; AGATGTGAACAGCAGTACCGCCTCC
>probe:Drosophila_2:1629554_at:499:627; Interrogation_Position=1508; Antisense; TCCACAGATTGTTGGCCTACGATCC
>probe:Drosophila_2:1629554_at:588:297; Interrogation_Position=1532; Antisense; CGCATAACGAGTGCCGCGGGATATT
>probe:Drosophila_2:1629554_at:168:459; Interrogation_Position=1551; Antisense; GATATTCTCCGACTGGTTCCGATTC
>probe:Drosophila_2:1629554_at:172:25; Interrogation_Position=1606; Antisense; ATACCAATGGAGTTCCGCGCAACAT
>probe:Drosophila_2:1629554_at:347:401; Interrogation_Position=1648; Antisense; GACAGTCGCTTCGATGCTCCAAAAT
>probe:Drosophila_2:1629554_at:312:535; Interrogation_Position=1701; Antisense; GGTCCAACGGGCCATTTACGAACAT
>probe:Drosophila_2:1629554_at:348:539; Interrogation_Position=1739; Antisense; GGTATCGCCCACGTGATGAGTTCGA

Paste this into a BLAST search page for me
GTCAGCTGTTTCAGGATGCCATGAAAAGCAAGAGCCCGTAGCTGTGGCCAGAGTAAATGCCTGTCCCGTGAAGGAGTGGCTCCCTTTTGGGCAAACAATAGAAGTGCACCCACGAGTTCAAGCAAGTTCAAGCAAATGTTCTGCCGCGATAGATGTGAACAGCAGTACCGCCTCCTCCACAGATTGTTGGCCTACGATCCCGCATAACGAGTGCCGCGGGATATTGATATTCTCCGACTGGTTCCGATTCATACCAATGGAGTTCCGCGCAACATGACAGTCGCTTCGATGCTCCAAAATGGTCCAACGGGCCATTTACGAACATGGTATCGCCCACGTGATGAGTTCGA

Full Affymetrix probeset data:

Annotations for 1629554_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime