FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629558_at:

>probe:Drosophila_2:1629558_at:542:83; Interrogation_Position=111; Antisense; AGTGGCCACCATTTCGAGCATTGAA
>probe:Drosophila_2:1629558_at:47:441; Interrogation_Position=156; Antisense; GATGTCCACATTTCTGTTTGTGCTT
>probe:Drosophila_2:1629558_at:119:705; Interrogation_Position=179; Antisense; TTGGGATAGCGTGTCACCCGGTAAT
>probe:Drosophila_2:1629558_at:369:493; Interrogation_Position=199; Antisense; GTAATGGTGATTCCCCTGATGCTGG
>probe:Drosophila_2:1629558_at:677:527; Interrogation_Position=222; Antisense; GGGAGGCTACTATATTCTACGCAAC
>probe:Drosophila_2:1629558_at:699:359; Interrogation_Position=242; Antisense; GCAACTGTTTGAATCGTCGGACCAA
>probe:Drosophila_2:1629558_at:725:69; Interrogation_Position=266; Antisense; AGGCGCCAAGGCTGCAGAGTTCCGT
>probe:Drosophila_2:1629558_at:612:405; Interrogation_Position=305; Antisense; GACTGATCACGGCAGGACCACGTAA
>probe:Drosophila_2:1629558_at:92:467; Interrogation_Position=370; Antisense; GTTGACGCTCCCAAGGACAACTAAA
>probe:Drosophila_2:1629558_at:397:27; Interrogation_Position=416; Antisense; ATACGAGTAGTCTCCTAACTTACAG
>probe:Drosophila_2:1629558_at:10:83; Interrogation_Position=458; Antisense; AGTGGGCGCTCCCAAAACTTGGCTA
>probe:Drosophila_2:1629558_at:632:475; Interrogation_Position=517; Antisense; GTTTTCTCTTTTGATATCCTTGGCA
>probe:Drosophila_2:1629558_at:116:345; Interrogation_Position=78; Antisense; GCTTGAAGCCATTTCGTATGCGATC
>probe:Drosophila_2:1629558_at:115:485; Interrogation_Position=93; Antisense; GTATGCGATCTACACAACAGTGGCC

Paste this into a BLAST search page for me
AGTGGCCACCATTTCGAGCATTGAAGATGTCCACATTTCTGTTTGTGCTTTTGGGATAGCGTGTCACCCGGTAATGTAATGGTGATTCCCCTGATGCTGGGGGAGGCTACTATATTCTACGCAACGCAACTGTTTGAATCGTCGGACCAAAGGCGCCAAGGCTGCAGAGTTCCGTGACTGATCACGGCAGGACCACGTAAGTTGACGCTCCCAAGGACAACTAAAATACGAGTAGTCTCCTAACTTACAGAGTGGGCGCTCCCAAAACTTGGCTAGTTTTCTCTTTTGATATCCTTGGCAGCTTGAAGCCATTTCGTATGCGATCGTATGCGATCTACACAACAGTGGCC

Full Affymetrix probeset data:

Annotations for 1629558_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720