FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629564_at:

>probe:Drosophila_2:1629564_at:37:539; Interrogation_Position=1018; Antisense; GGTAATCTGGGCAGCTCAGCGGCAT
>probe:Drosophila_2:1629564_at:625:281; Interrogation_Position=1051; Antisense; CTCGGAATCAACTCGATGCTGCTTA
>probe:Drosophila_2:1629564_at:225:447; Interrogation_Position=1065; Antisense; GATGCTGCTTATCGCGGTCGCCAGT
>probe:Drosophila_2:1629564_at:311:349; Interrogation_Position=612; Antisense; GCAGGAATCGGATCTCGGTGTGATT
>probe:Drosophila_2:1629564_at:492:533; Interrogation_Position=628; Antisense; GGTGTGATTTGTGCAGACGCCTTCA
>probe:Drosophila_2:1629564_at:337:425; Interrogation_Position=670; Antisense; GAGACGCTGCAGATCCTGAACAACA
>probe:Drosophila_2:1629564_at:125:419; Interrogation_Position=712; Antisense; GAGCTGAACTTCACTAGCACGGCGG
>probe:Drosophila_2:1629564_at:219:289; Interrogation_Position=731; Antisense; CGGCGGCCATAAAGCACCTGAAATT
>probe:Drosophila_2:1629564_at:450:245; Interrogation_Position=752; Antisense; AATTCTTTGGCAACCACGTGCTAGA
>probe:Drosophila_2:1629564_at:68:141; Interrogation_Position=767; Antisense; ACGTGCTAGAGACTCCAGATCCCAA
>probe:Drosophila_2:1629564_at:579:449; Interrogation_Position=784; Antisense; GATCCCAACTCAATCATCGTGGACG
>probe:Drosophila_2:1629564_at:659:351; Interrogation_Position=822; Antisense; GCAGCTGGTGAGCAATCACTTCCCT
>probe:Drosophila_2:1629564_at:146:109; Interrogation_Position=920; Antisense; AGAAGAACTACTGCATCTCGCCGCT
>probe:Drosophila_2:1629564_at:37:401; Interrogation_Position=976; Antisense; GACATCGACTCCATTGGCCGCTGTT

Paste this into a BLAST search page for me
GGTAATCTGGGCAGCTCAGCGGCATCTCGGAATCAACTCGATGCTGCTTAGATGCTGCTTATCGCGGTCGCCAGTGCAGGAATCGGATCTCGGTGTGATTGGTGTGATTTGTGCAGACGCCTTCAGAGACGCTGCAGATCCTGAACAACAGAGCTGAACTTCACTAGCACGGCGGCGGCGGCCATAAAGCACCTGAAATTAATTCTTTGGCAACCACGTGCTAGAACGTGCTAGAGACTCCAGATCCCAAGATCCCAACTCAATCATCGTGGACGGCAGCTGGTGAGCAATCACTTCCCTAGAAGAACTACTGCATCTCGCCGCTGACATCGACTCCATTGGCCGCTGTT

Full Affymetrix probeset data:

Annotations for 1629564_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720