Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629565_s_at:

>probe:Drosophila_2:1629565_s_at:124:37; Interrogation_Position=106; Antisense; ATCATGCTCTCCACGATGGGCAACT
>probe:Drosophila_2:1629565_s_at:345:439; Interrogation_Position=120; Antisense; GATGGGCAACTTTACGGCCTTCGAC
>probe:Drosophila_2:1629565_s_at:202:711; Interrogation_Position=139; Antisense; TTCGACGGAGGCGTTAACACCCAGA
>probe:Drosophila_2:1629565_s_at:627:103; Interrogation_Position=161; Antisense; AGACCATCCCGATCTGCATTATCGT
>probe:Drosophila_2:1629565_s_at:214:703; Interrogation_Position=179; Antisense; TTATCGTCATCGGAAGTGTCACCTT
>probe:Drosophila_2:1629565_s_at:521:219; Interrogation_Position=192; Antisense; AAGTGTCACCTTCGTAGTGGCCTTC
>probe:Drosophila_2:1629565_s_at:24:41; Interrogation_Position=271; Antisense; ATCTGCATGCTGATTCTGTTCGGCC
>probe:Drosophila_2:1629565_s_at:462:161; Interrogation_Position=335; Antisense; ACAAGTTCCTGTCCAGCATGGGCAA
>probe:Drosophila_2:1629565_s_at:724:443; Interrogation_Position=379; Antisense; GATGAGAACAATGCCGCCCAGGGAT
>probe:Drosophila_2:1629565_s_at:391:189; Interrogation_Position=458; Antisense; AACAGTATGAAACCGTGCCCAGCTC
>probe:Drosophila_2:1629565_s_at:552:377; Interrogation_Position=517; Antisense; GAAGCGGAGATCTACAGCCAGCGAC
>probe:Drosophila_2:1629565_s_at:683:75; Interrogation_Position=554; Antisense; AGGAGTTCGTCGATTTCTGGGCCTC
>probe:Drosophila_2:1629565_s_at:321:241; Interrogation_Position=580; Antisense; AATACGGACCTGATTCGATGGAGCA
>probe:Drosophila_2:1629565_s_at:34:121; Interrogation_Position=626; Antisense; AGCTGGGCATCTTCATCATGTCGTG

Paste this into a BLAST search page for me
ATCATGCTCTCCACGATGGGCAACTGATGGGCAACTTTACGGCCTTCGACTTCGACGGAGGCGTTAACACCCAGAAGACCATCCCGATCTGCATTATCGTTTATCGTCATCGGAAGTGTCACCTTAAGTGTCACCTTCGTAGTGGCCTTCATCTGCATGCTGATTCTGTTCGGCCACAAGTTCCTGTCCAGCATGGGCAAGATGAGAACAATGCCGCCCAGGGATAACAGTATGAAACCGTGCCCAGCTCGAAGCGGAGATCTACAGCCAGCGACAGGAGTTCGTCGATTTCTGGGCCTCAATACGGACCTGATTCGATGGAGCAAGCTGGGCATCTTCATCATGTCGTG

Full Affymetrix probeset data:

Annotations for 1629565_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime