FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629566_at:

>probe:Drosophila_2:1629566_at:452:21; Interrogation_Position=1034; Antisense; ATATCGGAATCAGCAACGTCTCGTC
>probe:Drosophila_2:1629566_at:379:63; Interrogation_Position=1145; Antisense; ATGTGCACACGGGTCAGGCCTGGAA
>probe:Drosophila_2:1629566_at:284:531; Interrogation_Position=1171; Antisense; GGGTACTACGGCAATCCCGTGGAGA
>probe:Drosophila_2:1629566_at:713:103; Interrogation_Position=1193; Antisense; AGACGCGACGCATGCAGGACTTCGA
>probe:Drosophila_2:1629566_at:681:401; Interrogation_Position=1210; Antisense; GACTTCGAGGGTTGGTTCCATACCG
>probe:Drosophila_2:1629566_at:683:25; Interrogation_Position=1229; Antisense; ATACCGGCGATCTGGGCTACTTCGA
>probe:Drosophila_2:1629566_at:570:447; Interrogation_Position=1293; Antisense; GATCCTCAAGTACAATGGCCTTCAC
>probe:Drosophila_2:1629566_at:308:727; Interrogation_Position=1320; Antisense; TTGGCCCACAGAGATCGAAACCGTT
>probe:Drosophila_2:1629566_at:439:39; Interrogation_Position=1333; Antisense; ATCGAAACCGTTATCGCGGAGCTCT
>probe:Drosophila_2:1629566_at:666:551; Interrogation_Position=1350; Antisense; GGAGCTCTCCCAGGTGCAGGATGTC
>probe:Drosophila_2:1629566_at:525:303; Interrogation_Position=1415; Antisense; CCGGTGCACTGGTCGTCAAGAGCAA
>probe:Drosophila_2:1629566_at:353:119; Interrogation_Position=1508; Antisense; AGCTGAGAGCCGGTGTCCAGTTCAC
>probe:Drosophila_2:1629566_at:83:213; Interrogation_Position=1573; Antisense; AAGACGGCACGCGACGTGTTTGTCG
>probe:Drosophila_2:1629566_at:33:301; Interrogation_Position=1596; Antisense; CGCCCTGCGCGTATCTGGAAAGTGA

Paste this into a BLAST search page for me
ATATCGGAATCAGCAACGTCTCGTCATGTGCACACGGGTCAGGCCTGGAAGGGTACTACGGCAATCCCGTGGAGAAGACGCGACGCATGCAGGACTTCGAGACTTCGAGGGTTGGTTCCATACCGATACCGGCGATCTGGGCTACTTCGAGATCCTCAAGTACAATGGCCTTCACTTGGCCCACAGAGATCGAAACCGTTATCGAAACCGTTATCGCGGAGCTCTGGAGCTCTCCCAGGTGCAGGATGTCCCGGTGCACTGGTCGTCAAGAGCAAAGCTGAGAGCCGGTGTCCAGTTCACAAGACGGCACGCGACGTGTTTGTCGCGCCCTGCGCGTATCTGGAAAGTGA

Full Affymetrix probeset data:

Annotations for 1629566_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720