FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629568_at:

>probe:Drosophila_2:1629568_at:477:685; Interrogation_Position=128; Antisense; TATTTGGTAACATAAAACGCCGTGA
>probe:Drosophila_2:1629568_at:14:177; Interrogation_Position=142; Antisense; AAACGCCGTGAATTGAACTTGGACG
>probe:Drosophila_2:1629568_at:212:229; Interrogation_Position=176; Antisense; AATGGACTATTGCTAATCTGCTTAA
>probe:Drosophila_2:1629568_at:601:35; Interrogation_Position=191; Antisense; ATCTGCTTAAGTGGATGCATGCGAA
>probe:Drosophila_2:1629568_at:722:413; Interrogation_Position=226; Antisense; GAGCGTCCGGAACTTTTTCTTCAAG
>probe:Drosophila_2:1629568_at:663:697; Interrogation_Position=24; Antisense; TTTTGAAAAGCTTAGACGCGGTCAC
>probe:Drosophila_2:1629568_at:724:427; Interrogation_Position=251; Antisense; GAGATACTGTGCGACCTGGAATTTT
>probe:Drosophila_2:1629568_at:452:325; Interrogation_Position=261; Antisense; GCGACCTGGAATTTTAGTACTCATA
>probe:Drosophila_2:1629568_at:516:561; Interrogation_Position=300; Antisense; GGAATTGCTGGGTGAACTGGACTAC
>probe:Drosophila_2:1629568_at:382:195; Interrogation_Position=314; Antisense; AACTGGACTACGAGCTGCAGCCCAA
>probe:Drosophila_2:1629568_at:707:119; Interrogation_Position=326; Antisense; AGCTGCAGCCCAACGACAATGTGTT
>probe:Drosophila_2:1629568_at:635:103; Interrogation_Position=37; Antisense; AGACGCGGTCACACATTTATTTACA
>probe:Drosophila_2:1629568_at:585:43; Interrogation_Position=61; Antisense; ATCGAACATATGATGGGCACGCCGG
>probe:Drosophila_2:1629568_at:18:595; Interrogation_Position=74; Antisense; TGGGCACGCCGGAATTAAAAATCAT

Paste this into a BLAST search page for me
TATTTGGTAACATAAAACGCCGTGAAAACGCCGTGAATTGAACTTGGACGAATGGACTATTGCTAATCTGCTTAAATCTGCTTAAGTGGATGCATGCGAAGAGCGTCCGGAACTTTTTCTTCAAGTTTTGAAAAGCTTAGACGCGGTCACGAGATACTGTGCGACCTGGAATTTTGCGACCTGGAATTTTAGTACTCATAGGAATTGCTGGGTGAACTGGACTACAACTGGACTACGAGCTGCAGCCCAAAGCTGCAGCCCAACGACAATGTGTTAGACGCGGTCACACATTTATTTACAATCGAACATATGATGGGCACGCCGGTGGGCACGCCGGAATTAAAAATCAT

Full Affymetrix probeset data:

Annotations for 1629568_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720