Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629569_at:

>probe:Drosophila_2:1629569_at:387:283; Interrogation_Position=2335; Antisense; CTGTCCAACTGTCCCAAGCTAAAGA
>probe:Drosophila_2:1629569_at:437:211; Interrogation_Position=2356; Antisense; AAGAAGCTCTTCTTGTCGGCGGTGC
>probe:Drosophila_2:1629569_at:694:381; Interrogation_Position=2392; Antisense; GAACGCGATCTCATGCATATTGCCG
>probe:Drosophila_2:1629569_at:625:237; Interrogation_Position=2428; Antisense; AATCTGGAGCAGCTTGACCTCATGG
>probe:Drosophila_2:1629569_at:352:413; Interrogation_Position=2443; Antisense; GACCTCATGGGCATTCTGAACATAA
>probe:Drosophila_2:1629569_at:390:401; Interrogation_Position=2485; Antisense; GACATTCTGGTCAACTGTCCCAAGC
>probe:Drosophila_2:1629569_at:180:301; Interrogation_Position=2503; Antisense; CCCAAGCTGCAGTTGCTGGACTTGA
>probe:Drosophila_2:1629569_at:322:333; Interrogation_Position=2517; Antisense; GCTGGACTTGAGTTTCTGTGACAAC
>probe:Drosophila_2:1629569_at:714:639; Interrogation_Position=2550; Antisense; TCGGGATTTCGATTTGCTGGCGGAA
>probe:Drosophila_2:1629569_at:126:333; Interrogation_Position=2565; Antisense; GCTGGCGGAATGGTCGCGACAATTT
>probe:Drosophila_2:1629569_at:594:113; Interrogation_Position=2605; Antisense; AGCAGTCGACGTCACTGAACCGGAA
>probe:Drosophila_2:1629569_at:699:559; Interrogation_Position=2660; Antisense; GGACAATCCAGTCCTTGTAGCTACA
>probe:Drosophila_2:1629569_at:705:487; Interrogation_Position=2712; Antisense; GTACTTTTAGATCCCACATATTTGT
>probe:Drosophila_2:1629569_at:370:151; Interrogation_Position=2742; Antisense; ACATTCTCCCTCTTCATTTATAGTA

Paste this into a BLAST search page for me
CTGTCCAACTGTCCCAAGCTAAAGAAAGAAGCTCTTCTTGTCGGCGGTGCGAACGCGATCTCATGCATATTGCCGAATCTGGAGCAGCTTGACCTCATGGGACCTCATGGGCATTCTGAACATAAGACATTCTGGTCAACTGTCCCAAGCCCCAAGCTGCAGTTGCTGGACTTGAGCTGGACTTGAGTTTCTGTGACAACTCGGGATTTCGATTTGCTGGCGGAAGCTGGCGGAATGGTCGCGACAATTTAGCAGTCGACGTCACTGAACCGGAAGGACAATCCAGTCCTTGTAGCTACAGTACTTTTAGATCCCACATATTTGTACATTCTCCCTCTTCATTTATAGTA

Full Affymetrix probeset data:

Annotations for 1629569_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime