Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629574_at:

>probe:Drosophila_2:1629574_at:726:207; Interrogation_Position=1046; Antisense; AAGCTTCTGCGGCAACAGGTGTTCT
>probe:Drosophila_2:1629574_at:129:155; Interrogation_Position=1060; Antisense; ACAGGTGTTCTTACTCGCCGAAAGA
>probe:Drosophila_2:1629574_at:359:27; Interrogation_Position=1123; Antisense; ATAGCTGATCATCCGTTTTTCTACG
>probe:Drosophila_2:1629574_at:414:493; Interrogation_Position=1165; Antisense; GTCATTTACTTTCAGGGTCACATCG
>probe:Drosophila_2:1629574_at:70:495; Interrogation_Position=1181; Antisense; GTCACATCGTTGAACCACGCTGGTA
>probe:Drosophila_2:1629574_at:125:415; Interrogation_Position=619; Antisense; GACCAAACTCATATAGCCGACTTCT
>probe:Drosophila_2:1629574_at:30:319; Interrogation_Position=634; Antisense; GCCGACTTCTATGTATCAGCTAACG
>probe:Drosophila_2:1629574_at:116:445; Interrogation_Position=675; Antisense; GATGATGACTTTGTCTGCATCCCTA
>probe:Drosophila_2:1629574_at:81:95; Interrogation_Position=731; Antisense; AGATTATCGAACTACCCTACTGGAA
>probe:Drosophila_2:1629574_at:593:561; Interrogation_Position=752; Antisense; GGAACTCAACTCTTTCTATGCGCAT
>probe:Drosophila_2:1629574_at:569:683; Interrogation_Position=768; Antisense; TATGCGCATCATTCTGCCCAATAGT
>probe:Drosophila_2:1629574_at:368:601; Interrogation_Position=939; Antisense; TGTATTTAAGCCCTCAGCTGACTTA
>probe:Drosophila_2:1629574_at:149:101; Interrogation_Position=954; Antisense; AGCTGACTTAAATGGGCTCGTCCTA
>probe:Drosophila_2:1629574_at:75:573; Interrogation_Position=968; Antisense; GGCTCGTCCTAGAATCTGGTGCTAA

Paste this into a BLAST search page for me
AAGCTTCTGCGGCAACAGGTGTTCTACAGGTGTTCTTACTCGCCGAAAGAATAGCTGATCATCCGTTTTTCTACGGTCATTTACTTTCAGGGTCACATCGGTCACATCGTTGAACCACGCTGGTAGACCAAACTCATATAGCCGACTTCTGCCGACTTCTATGTATCAGCTAACGGATGATGACTTTGTCTGCATCCCTAAGATTATCGAACTACCCTACTGGAAGGAACTCAACTCTTTCTATGCGCATTATGCGCATCATTCTGCCCAATAGTTGTATTTAAGCCCTCAGCTGACTTAAGCTGACTTAAATGGGCTCGTCCTAGGCTCGTCCTAGAATCTGGTGCTAA

Full Affymetrix probeset data:

Annotations for 1629574_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime