Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629576_at:

>probe:Drosophila_2:1629576_at:398:353; Interrogation_Position=1286; Antisense; GAATGACATTATCTTCGGGCCGAAG
>probe:Drosophila_2:1629576_at:188:241; Interrogation_Position=1329; Antisense; AATACACCCGAGATTATCAACCTGG
>probe:Drosophila_2:1629576_at:119:287; Interrogation_Position=1350; Antisense; CTGGGCAACTTTGACAACTCGCTGC
>probe:Drosophila_2:1629576_at:285:319; Interrogation_Position=1373; Antisense; GCCGCCAACCTTTTTCAAGAATCTA
>probe:Drosophila_2:1629576_at:342:109; Interrogation_Position=1390; Antisense; AGAATCTATGCAACTCGTCGCGACA
>probe:Drosophila_2:1629576_at:106:87; Interrogation_Position=1417; Antisense; AGTCTCTCGGGCTGTACGTGGCCAA
>probe:Drosophila_2:1629576_at:546:595; Interrogation_Position=1442; Antisense; TGTGATGAACAGACTCTCTTCGCGT
>probe:Drosophila_2:1629576_at:354:207; Interrogation_Position=1476; Antisense; AAGCTGGAGCTGTCCATCTTGCGCG
>probe:Drosophila_2:1629576_at:225:271; Interrogation_Position=1502; Antisense; CATCCTCGATGTGCAGAGCGACGAA
>probe:Drosophila_2:1629576_at:672:485; Interrogation_Position=1535; Antisense; GTAGACCGACTGATACTCGCAATTT
>probe:Drosophila_2:1629576_at:603:483; Interrogation_Position=1607; Antisense; GTAGTAGGCCTGTCTGAACCATTTC
>probe:Drosophila_2:1629576_at:524:697; Interrogation_Position=1650; Antisense; TTTTTCCGTGTTCAAACGTCTGCGT
>probe:Drosophila_2:1629576_at:501:595; Interrogation_Position=1677; Antisense; TGTGCCGCCCACTTGTAAAATGTAT
>probe:Drosophila_2:1629576_at:173:427; Interrogation_Position=1783; Antisense; GAGATTTCGAATTTGTCCCTATTTA

Paste this into a BLAST search page for me
GAATGACATTATCTTCGGGCCGAAGAATACACCCGAGATTATCAACCTGGCTGGGCAACTTTGACAACTCGCTGCGCCGCCAACCTTTTTCAAGAATCTAAGAATCTATGCAACTCGTCGCGACAAGTCTCTCGGGCTGTACGTGGCCAATGTGATGAACAGACTCTCTTCGCGTAAGCTGGAGCTGTCCATCTTGCGCGCATCCTCGATGTGCAGAGCGACGAAGTAGACCGACTGATACTCGCAATTTGTAGTAGGCCTGTCTGAACCATTTCTTTTTCCGTGTTCAAACGTCTGCGTTGTGCCGCCCACTTGTAAAATGTATGAGATTTCGAATTTGTCCCTATTTA

Full Affymetrix probeset data:

Annotations for 1629576_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime