FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629577_at:

>probe:Drosophila_2:1629577_at:571:393; Interrogation_Position=1639; Antisense; GAAATGGATCTCAAGCTCAGCTGTT
>probe:Drosophila_2:1629577_at:321:207; Interrogation_Position=1672; Antisense; AAGCGTGCTGATATTGCGGAGAAAC
>probe:Drosophila_2:1629577_at:429:495; Interrogation_Position=1754; Antisense; GTCAAAACTCCATTATCCAATCCAG
>probe:Drosophila_2:1629577_at:194:379; Interrogation_Position=1786; Antisense; GAAGCCAGTGAATCTCCGGAGCTAA
>probe:Drosophila_2:1629577_at:395:131; Interrogation_Position=1818; Antisense; ACGCATGTATCCAGAAACGCCCAAA
>probe:Drosophila_2:1629577_at:702:165; Interrogation_Position=1840; Antisense; AAATCGAGCAAATCGCAGCGCAGCA
>probe:Drosophila_2:1629577_at:331:559; Interrogation_Position=1923; Antisense; GGACAAGCTGCAGGCCTACATTGAA
>probe:Drosophila_2:1629577_at:174:69; Interrogation_Position=1934; Antisense; AGGCCTACATTGAACTGCTGCTCAG
>probe:Drosophila_2:1629577_at:522:83; Interrogation_Position=1969; Antisense; AGTGATTTCGACAGGCTCGACGAGA
>probe:Drosophila_2:1629577_at:522:281; Interrogation_Position=1984; Antisense; CTCGACGAGATCTTGGCCATGACAT
>probe:Drosophila_2:1629577_at:661:651; Interrogation_Position=2058; Antisense; TAAGCCTCCACCTTGGAAGTGCTGA
>probe:Drosophila_2:1629577_at:56:87; Interrogation_Position=2075; Antisense; AGTGCTGACAACGAGAGATGCTTTC
>probe:Drosophila_2:1629577_at:244:231; Interrogation_Position=2142; Antisense; AATGACTGCCTCTTTGAATGGCCGC
>probe:Drosophila_2:1629577_at:168:371; Interrogation_Position=2157; Antisense; GAATGGCCGCTACAATGGACATTGT

Paste this into a BLAST search page for me
GAAATGGATCTCAAGCTCAGCTGTTAAGCGTGCTGATATTGCGGAGAAACGTCAAAACTCCATTATCCAATCCAGGAAGCCAGTGAATCTCCGGAGCTAAACGCATGTATCCAGAAACGCCCAAAAAATCGAGCAAATCGCAGCGCAGCAGGACAAGCTGCAGGCCTACATTGAAAGGCCTACATTGAACTGCTGCTCAGAGTGATTTCGACAGGCTCGACGAGACTCGACGAGATCTTGGCCATGACATTAAGCCTCCACCTTGGAAGTGCTGAAGTGCTGACAACGAGAGATGCTTTCAATGACTGCCTCTTTGAATGGCCGCGAATGGCCGCTACAATGGACATTGT

Full Affymetrix probeset data:

Annotations for 1629577_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720