Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629578_at:

>probe:Drosophila_2:1629578_at:565:639; Interrogation_Position=1084; Antisense; TCGTGTCCGAGAAGCTGCCAGCGTA
>probe:Drosophila_2:1629578_at:716:627; Interrogation_Position=1099; Antisense; TGCCAGCGTACGTGCAGTTCTACGA
>probe:Drosophila_2:1629578_at:250:215; Interrogation_Position=1179; Antisense; AAGATGCGTCTGCTGACCTTCATGC
>probe:Drosophila_2:1629578_at:236:421; Interrogation_Position=1214; Antisense; GAGCAGCCCGGAGATGACATTCGAA
>probe:Drosophila_2:1629578_at:663:301; Interrogation_Position=1281; Antisense; CCCTTCGTCATCGAGGTGCTGAAAA
>probe:Drosophila_2:1629578_at:546:179; Interrogation_Position=1303; Antisense; AAACAAAGCTGGTACGCGCACGACT
>probe:Drosophila_2:1629578_at:566:323; Interrogation_Position=1318; Antisense; GCGCACGACTAGATCAGGCCAATCA
>probe:Drosophila_2:1629578_at:727:535; Interrogation_Position=1346; Antisense; GGTACACATCTCATCGACAATGCAC
>probe:Drosophila_2:1629578_at:220:397; Interrogation_Position=1361; Antisense; GACAATGCACCGAACCTTTGGAGCA
>probe:Drosophila_2:1629578_at:121:355; Interrogation_Position=1383; Antisense; GCACCACAATGGGAGCAGCTTCGCG
>probe:Drosophila_2:1629578_at:144:117; Interrogation_Position=1399; Antisense; AGCTTCGCGATTTGCTGCAGGCATG
>probe:Drosophila_2:1629578_at:372:225; Interrogation_Position=1425; Antisense; AAGGAGAACCTCAGCACAGTGCGCG
>probe:Drosophila_2:1629578_at:722:107; Interrogation_Position=1498; Antisense; AGAAGCTGATACACTAGGCGCACCA
>probe:Drosophila_2:1629578_at:524:679; Interrogation_Position=1512; Antisense; TAGGCGCACCACTTCCAAAAAATTG

Paste this into a BLAST search page for me
TCGTGTCCGAGAAGCTGCCAGCGTATGCCAGCGTACGTGCAGTTCTACGAAAGATGCGTCTGCTGACCTTCATGCGAGCAGCCCGGAGATGACATTCGAACCCTTCGTCATCGAGGTGCTGAAAAAAACAAAGCTGGTACGCGCACGACTGCGCACGACTAGATCAGGCCAATCAGGTACACATCTCATCGACAATGCACGACAATGCACCGAACCTTTGGAGCAGCACCACAATGGGAGCAGCTTCGCGAGCTTCGCGATTTGCTGCAGGCATGAAGGAGAACCTCAGCACAGTGCGCGAGAAGCTGATACACTAGGCGCACCATAGGCGCACCACTTCCAAAAAATTG

Full Affymetrix probeset data:

Annotations for 1629578_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime