Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629579_at:

>probe:Drosophila_2:1629579_at:626:263; Interrogation_Position=4308; Antisense; CAGCAGGCGCATGTGTGGAAGTTCA
>probe:Drosophila_2:1629579_at:443:585; Interrogation_Position=4323; Antisense; TGGAAGTTCATTCCGCCCATCGAGG
>probe:Drosophila_2:1629579_at:184:413; Interrogation_Position=4349; Antisense; GACCGTCGTGGAGCAGTGAAATGTT
>probe:Drosophila_2:1629579_at:111:509; Interrogation_Position=4364; Antisense; GTGAAATGTTACCTGTCGCTAGTTT
>probe:Drosophila_2:1629579_at:65:503; Interrogation_Position=4378; Antisense; GTCGCTAGTTTAATTTCGTTACAAT
>probe:Drosophila_2:1629579_at:640:475; Interrogation_Position=4413; Antisense; GTATTGTGTATACACCCCATACTAA
>probe:Drosophila_2:1629579_at:329:669; Interrogation_Position=4432; Antisense; TACTAATCCCCTACTCTTGTTAAAG
>probe:Drosophila_2:1629579_at:693:707; Interrogation_Position=4451; Antisense; TTAAAGTATTTGATTCCCACGCGCC
>probe:Drosophila_2:1629579_at:349:135; Interrogation_Position=4469; Antisense; ACGCGCCCTGTTATATCCGTAAACA
>probe:Drosophila_2:1629579_at:50:165; Interrogation_Position=4579; Antisense; AAAGTTATACTGTGCCCCAAGCTTG
>probe:Drosophila_2:1629579_at:555:657; Interrogation_Position=4634; Antisense; TAACCTATAGTTCATGCCTGTAAAA
>probe:Drosophila_2:1629579_at:540:25; Interrogation_Position=4694; Antisense; ATAGATAGCCAATGTTCCGCGCACT
>probe:Drosophila_2:1629579_at:204:229; Interrogation_Position=4704; Antisense; AATGTTCCGCGCACTAGAAGCCACG
>probe:Drosophila_2:1629579_at:331:379; Interrogation_Position=4720; Antisense; GAAGCCACGCCAAGCATTATACATT

Paste this into a BLAST search page for me
CAGCAGGCGCATGTGTGGAAGTTCATGGAAGTTCATTCCGCCCATCGAGGGACCGTCGTGGAGCAGTGAAATGTTGTGAAATGTTACCTGTCGCTAGTTTGTCGCTAGTTTAATTTCGTTACAATGTATTGTGTATACACCCCATACTAATACTAATCCCCTACTCTTGTTAAAGTTAAAGTATTTGATTCCCACGCGCCACGCGCCCTGTTATATCCGTAAACAAAAGTTATACTGTGCCCCAAGCTTGTAACCTATAGTTCATGCCTGTAAAAATAGATAGCCAATGTTCCGCGCACTAATGTTCCGCGCACTAGAAGCCACGGAAGCCACGCCAAGCATTATACATT

Full Affymetrix probeset data:

Annotations for 1629579_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime