FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629584_at:

>probe:Drosophila_2:1629584_at:398:83; Interrogation_Position=137; Antisense; AGTGGACTGCATCGCAAGTATCGCC
>probe:Drosophila_2:1629584_at:307:411; Interrogation_Position=210; Antisense; GACGCAATCGGCTGGGTGAGCACAA
>probe:Drosophila_2:1629584_at:534:583; Interrogation_Position=311; Antisense; TGGCTAGACTCCCAAGATCGCATTA
>probe:Drosophila_2:1629584_at:382:679; Interrogation_Position=32; Antisense; TATGTACATTATTTTTGGTCCCCGT
>probe:Drosophila_2:1629584_at:468:345; Interrogation_Position=330; Antisense; GCATTACTCGCGACATGGACGAACA
>probe:Drosophila_2:1629584_at:372:587; Interrogation_Position=345; Antisense; TGGACGAACATGTGCGCAAGCGGAC
>probe:Drosophila_2:1629584_at:578:205; Interrogation_Position=362; Antisense; AAGCGGACGGCCCAGATCTCGAAAC
>probe:Drosophila_2:1629584_at:330:609; Interrogation_Position=390; Antisense; TGAGAAACCTCAGCGATCACAACCA
>probe:Drosophila_2:1629584_at:462:155; Interrogation_Position=414; Antisense; ACAAGGTTCAGGTGCGCAAGGACGA
>probe:Drosophila_2:1629584_at:571:377; Interrogation_Position=451; Antisense; GAAGCTTCTCCGAAAACTGACTCAT
>probe:Drosophila_2:1629584_at:104:611; Interrogation_Position=468; Antisense; TGACTCATCTCTACGAGGCGCAGAA
>probe:Drosophila_2:1629584_at:717:107; Interrogation_Position=489; Antisense; AGAACGCCAGCACTATTTCGCGATT
>probe:Drosophila_2:1629584_at:510:681; Interrogation_Position=76; Antisense; TATGAGCAACTCATCGGCCTTTTAC
>probe:Drosophila_2:1629584_at:518:41; Interrogation_Position=88; Antisense; ATCGGCCTTTTACGTGCATTTGGAG

Paste this into a BLAST search page for me
AGTGGACTGCATCGCAAGTATCGCCGACGCAATCGGCTGGGTGAGCACAATGGCTAGACTCCCAAGATCGCATTATATGTACATTATTTTTGGTCCCCGTGCATTACTCGCGACATGGACGAACATGGACGAACATGTGCGCAAGCGGACAAGCGGACGGCCCAGATCTCGAAACTGAGAAACCTCAGCGATCACAACCAACAAGGTTCAGGTGCGCAAGGACGAGAAGCTTCTCCGAAAACTGACTCATTGACTCATCTCTACGAGGCGCAGAAAGAACGCCAGCACTATTTCGCGATTTATGAGCAACTCATCGGCCTTTTACATCGGCCTTTTACGTGCATTTGGAG

Full Affymetrix probeset data:

Annotations for 1629584_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720