FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629587_at:

>probe:Drosophila_2:1629587_at:339:681; Interrogation_Position=4513; Antisense; TATGGATCATCCTCGCAGCGCTGTA
>probe:Drosophila_2:1629587_at:482:161; Interrogation_Position=4558; Antisense; AAATCGAATTCTCTTTCTCTACCCG
>probe:Drosophila_2:1629587_at:536:85; Interrogation_Position=4585; Antisense; AGTCCGACGGTGGTTGGCAATCAGC
>probe:Drosophila_2:1629587_at:430:141; Interrogation_Position=4614; Antisense; ACGGAGTAACTCATTGCGGATCGAC
>probe:Drosophila_2:1629587_at:190:199; Interrogation_Position=4639; Antisense; AACGATATACTGCTGCGTCGATCCT
>probe:Drosophila_2:1629587_at:386:501; Interrogation_Position=4716; Antisense; GTCGTCGCTGGAAGAGATCGGCATA
>probe:Drosophila_2:1629587_at:725:449; Interrogation_Position=4731; Antisense; GATCGGCATAAGTCACTTCACTACC
>probe:Drosophila_2:1629587_at:27:455; Interrogation_Position=4791; Antisense; GATATCCCTAAACGGTAGCATCGGT
>probe:Drosophila_2:1629587_at:86:109; Interrogation_Position=4820; Antisense; AGAACCAGATCTCCTTGCAGGTGAC
>probe:Drosophila_2:1629587_at:382:435; Interrogation_Position=4904; Antisense; GAGGTGGCATTAACCCATCTGGAGC
>probe:Drosophila_2:1629587_at:431:585; Interrogation_Position=4970; Antisense; TGGCAATCAATACCGCTGACCTGGG
>probe:Drosophila_2:1629587_at:311:209; Interrogation_Position=5036; Antisense; AAGCACAGGACTCGCTGGGACAGCA
>probe:Drosophila_2:1629587_at:475:155; Interrogation_Position=5055; Antisense; ACAGCAGTCATCTCAGGTGTCATCG
>probe:Drosophila_2:1629587_at:48:497; Interrogation_Position=5073; Antisense; GTCATCGCCACAGCATTTGCAGGGA

Paste this into a BLAST search page for me
TATGGATCATCCTCGCAGCGCTGTAAAATCGAATTCTCTTTCTCTACCCGAGTCCGACGGTGGTTGGCAATCAGCACGGAGTAACTCATTGCGGATCGACAACGATATACTGCTGCGTCGATCCTGTCGTCGCTGGAAGAGATCGGCATAGATCGGCATAAGTCACTTCACTACCGATATCCCTAAACGGTAGCATCGGTAGAACCAGATCTCCTTGCAGGTGACGAGGTGGCATTAACCCATCTGGAGCTGGCAATCAATACCGCTGACCTGGGAAGCACAGGACTCGCTGGGACAGCAACAGCAGTCATCTCAGGTGTCATCGGTCATCGCCACAGCATTTGCAGGGA

Full Affymetrix probeset data:

Annotations for 1629587_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720