FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629588_at:

>probe:Drosophila_2:1629588_at:369:555; Interrogation_Position=178; Antisense; GGACCAGTTAGCTATAGTGCCGCTC
>probe:Drosophila_2:1629588_at:290:309; Interrogation_Position=204; Antisense; CCAGGCGTCAGTTCACAAGGAGTTC
>probe:Drosophila_2:1629588_at:341:77; Interrogation_Position=221; Antisense; AGGAGTTCTACAGCTTCTATGCCAA
>probe:Drosophila_2:1629588_at:372:543; Interrogation_Position=261; Antisense; GGATAAGGCTGCTCTCCAGAGGGCT
>probe:Drosophila_2:1629588_at:571:79; Interrogation_Position=280; Antisense; AGGGCTCTTGCCTCGGTCAAGAAGA
>probe:Drosophila_2:1629588_at:610:211; Interrogation_Position=301; Antisense; AAGAACATTCGCGTCATCTTCATCA
>probe:Drosophila_2:1629588_at:161:109; Interrogation_Position=350; Antisense; AGAATGCCGTTTTGGCCCTGGCTAA
>probe:Drosophila_2:1629588_at:31:105; Interrogation_Position=392; Antisense; AGACTGCCATATATGTGCTGCACAA
>probe:Drosophila_2:1629588_at:358:559; Interrogation_Position=506; Antisense; GGACACCTGAGGATGCTGCCAATGC
>probe:Drosophila_2:1629588_at:99:331; Interrogation_Position=534; Antisense; GCGGGCAATCCAATCGCAGTACGAT
>probe:Drosophila_2:1629588_at:82:91; Interrogation_Position=551; Antisense; AGTACGATCAACTCGGCGGCTCCAG
>probe:Drosophila_2:1629588_at:464:87; Interrogation_Position=578; Antisense; AGTCCATCAACGGTGGCGTGGCTAA
>probe:Drosophila_2:1629588_at:248:33; Interrogation_Position=607; Antisense; ATCAACTTTGCATCCCAGGGAGCTG
>probe:Drosophila_2:1629588_at:718:431; Interrogation_Position=693; Antisense; GAGTCGCCTGCGTCACTAGAAAATC

Paste this into a BLAST search page for me
GGACCAGTTAGCTATAGTGCCGCTCCCAGGCGTCAGTTCACAAGGAGTTCAGGAGTTCTACAGCTTCTATGCCAAGGATAAGGCTGCTCTCCAGAGGGCTAGGGCTCTTGCCTCGGTCAAGAAGAAAGAACATTCGCGTCATCTTCATCAAGAATGCCGTTTTGGCCCTGGCTAAAGACTGCCATATATGTGCTGCACAAGGACACCTGAGGATGCTGCCAATGCGCGGGCAATCCAATCGCAGTACGATAGTACGATCAACTCGGCGGCTCCAGAGTCCATCAACGGTGGCGTGGCTAAATCAACTTTGCATCCCAGGGAGCTGGAGTCGCCTGCGTCACTAGAAAATC

Full Affymetrix probeset data:

Annotations for 1629588_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720