FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629589_at:

>probe:Drosophila_2:1629589_at:189:631; Interrogation_Position=1016; Antisense; TCCTCTTTCTGGAACTGCTCAGCAA
>probe:Drosophila_2:1629589_at:489:29; Interrogation_Position=1046; Antisense; ATAACGGCTACCTGTGGGTGCAGAT
>probe:Drosophila_2:1629589_at:640:97; Interrogation_Position=1067; Antisense; AGATGCTCTGGATTTGCTTTCACTT
>probe:Drosophila_2:1629589_at:47:723; Interrogation_Position=1126; Antisense; TTGGCTGCCCGAGAGTCCCGTAAAA
>probe:Drosophila_2:1629589_at:594:417; Interrogation_Position=1174; Antisense; GAGCGGAAAGTGCACGAGCCCATTC
>probe:Drosophila_2:1629589_at:539:91; Interrogation_Position=1217; Antisense; AGTTTTGGCAGCAGTTACTCGTCGT
>probe:Drosophila_2:1629589_at:626:667; Interrogation_Position=1232; Antisense; TACTCGTCGTAGATGCTGACTTCTC
>probe:Drosophila_2:1629589_at:296:129; Interrogation_Position=1285; Antisense; ACCATTCTGACATCGTTTGCATCCG
>probe:Drosophila_2:1629589_at:332:27; Interrogation_Position=1312; Antisense; ATAGCCACCTATCTCGTGATTCTCA
>probe:Drosophila_2:1629589_at:207:513; Interrogation_Position=1327; Antisense; GTGATTCTCATTCAGTTTCAACGGA
>probe:Drosophila_2:1629589_at:477:381; Interrogation_Position=771; Antisense; GAACGGCGAAACCTTGCCCAGTGAA
>probe:Drosophila_2:1629589_at:190:349; Interrogation_Position=821; Antisense; GCAGTCTAATCCTCAACGTGGAGTT
>probe:Drosophila_2:1629589_at:593:331; Interrogation_Position=918; Antisense; GCTGGGAAAATGTGTCCACCTCCTG
>probe:Drosophila_2:1629589_at:665:7; Interrogation_Position=958; Antisense; ATTGCGGTTCTCTTCATCCTGGTGT

Paste this into a BLAST search page for me
TCCTCTTTCTGGAACTGCTCAGCAAATAACGGCTACCTGTGGGTGCAGATAGATGCTCTGGATTTGCTTTCACTTTTGGCTGCCCGAGAGTCCCGTAAAAGAGCGGAAAGTGCACGAGCCCATTCAGTTTTGGCAGCAGTTACTCGTCGTTACTCGTCGTAGATGCTGACTTCTCACCATTCTGACATCGTTTGCATCCGATAGCCACCTATCTCGTGATTCTCAGTGATTCTCATTCAGTTTCAACGGAGAACGGCGAAACCTTGCCCAGTGAAGCAGTCTAATCCTCAACGTGGAGTTGCTGGGAAAATGTGTCCACCTCCTGATTGCGGTTCTCTTCATCCTGGTGT

Full Affymetrix probeset data:

Annotations for 1629589_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720