FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629590_at:

>probe:Drosophila_2:1629590_at:711:223; Interrogation_Position=1019; Antisense; AAGGAGATTTCCTACACCCTATACG
>probe:Drosophila_2:1629590_at:724:241; Interrogation_Position=1045; Antisense; AATACCCACTGAGTTTTGGTGCGTG
>probe:Drosophila_2:1629590_at:496:229; Interrogation_Position=1085; Antisense; AATGAGATCTTTCTATCCGACCACT
>probe:Drosophila_2:1629590_at:223:223; Interrogation_Position=1124; Antisense; AAGGGATACTTTCTGCTGACTAGAC
>probe:Drosophila_2:1629590_at:70:251; Interrogation_Position=1161; Antisense; CAATGGCTGCCACTTTGATGGTCTA
>probe:Drosophila_2:1629590_at:549:589; Interrogation_Position=1179; Antisense; TGGTCTACGAACTGGTGCTCATCAA
>probe:Drosophila_2:1629590_at:257:605; Interrogation_Position=681; Antisense; TGATACTCATCTGCCGCGGAATGCA
>probe:Drosophila_2:1629590_at:519:463; Interrogation_Position=711; Antisense; GATTCCAGCAGATGCACTGGCGCAT
>probe:Drosophila_2:1629590_at:700:433; Interrogation_Position=778; Antisense; GAGGATTCGCTGTGATCTTCTGGAC
>probe:Drosophila_2:1629590_at:506:513; Interrogation_Position=807; Antisense; GTGATCTTCTGGGTATCTACGACAA
>probe:Drosophila_2:1629590_at:277:15; Interrogation_Position=835; Antisense; ATTATCCGGTTTGATCGTGCTATCC
>probe:Drosophila_2:1629590_at:301:697; Interrogation_Position=940; Antisense; TTTCTGGTTTTGCTTGTCTTATGTC
>probe:Drosophila_2:1629590_at:55:499; Interrogation_Position=955; Antisense; GTCTTATGTCATCATTCGCGTACTA
>probe:Drosophila_2:1629590_at:623:179; Interrogation_Position=979; Antisense; AAACATGATGTTCGCTGCATCCTCG

Paste this into a BLAST search page for me
AAGGAGATTTCCTACACCCTATACGAATACCCACTGAGTTTTGGTGCGTGAATGAGATCTTTCTATCCGACCACTAAGGGATACTTTCTGCTGACTAGACCAATGGCTGCCACTTTGATGGTCTATGGTCTACGAACTGGTGCTCATCAATGATACTCATCTGCCGCGGAATGCAGATTCCAGCAGATGCACTGGCGCATGAGGATTCGCTGTGATCTTCTGGACGTGATCTTCTGGGTATCTACGACAAATTATCCGGTTTGATCGTGCTATCCTTTCTGGTTTTGCTTGTCTTATGTCGTCTTATGTCATCATTCGCGTACTAAAACATGATGTTCGCTGCATCCTCG

Full Affymetrix probeset data:

Annotations for 1629590_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720