Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629591_at:

>probe:Drosophila_2:1629591_at:370:145; Interrogation_Position=10364; Antisense; ACTCCGCCCTCCAATATTATTTTGG
>probe:Drosophila_2:1629591_at:187:349; Interrogation_Position=10392; Antisense; GCAGCTTACACGTTTCCAACTGGAT
>probe:Drosophila_2:1629591_at:286:489; Interrogation_Position=10428; Antisense; GTACTACAAACTTCAGCTCGAGCTA
>probe:Drosophila_2:1629591_at:484:117; Interrogation_Position=10442; Antisense; AGCTCGAGCTACCAAAACACCAATT
>probe:Drosophila_2:1629591_at:649:455; Interrogation_Position=10506; Antisense; GATACTGCCGCAGCTCGTATAATAA
>probe:Drosophila_2:1629591_at:419:175; Interrogation_Position=10592; Antisense; AAACCAATGCCTTCAGGATCCACTA
>probe:Drosophila_2:1629591_at:144:561; Interrogation_Position=10622; Antisense; GGAACTAATTTGTCCATTACCAGTA
>probe:Drosophila_2:1629591_at:125:61; Interrogation_Position=10682; Antisense; ATGTCGTGGTGTTTACCAGTGTCCC
>probe:Drosophila_2:1629591_at:69:599; Interrogation_Position=10701; Antisense; TGTCCCGCATATTATTATCCCGTTA
>probe:Drosophila_2:1629591_at:348:451; Interrogation_Position=10732; Antisense; GATCATTTGTAATAGCCGTGGACTT
>probe:Drosophila_2:1629591_at:581:661; Interrogation_Position=10789; Antisense; TAAAGCGAGGCCACACAACGACCGT
>probe:Drosophila_2:1629591_at:344:325; Interrogation_Position=10817; Antisense; GCGAACGGCCGTTAACATGACATTT
>probe:Drosophila_2:1629591_at:27:57; Interrogation_Position=10833; Antisense; ATGACATTTGGACAGGAAACCCCTA
>probe:Drosophila_2:1629591_at:657:89; Interrogation_Position=10913; Antisense; AGTAGGCAACACAGCAATTCGGAAT

Paste this into a BLAST search page for me
ACTCCGCCCTCCAATATTATTTTGGGCAGCTTACACGTTTCCAACTGGATGTACTACAAACTTCAGCTCGAGCTAAGCTCGAGCTACCAAAACACCAATTGATACTGCCGCAGCTCGTATAATAAAAACCAATGCCTTCAGGATCCACTAGGAACTAATTTGTCCATTACCAGTAATGTCGTGGTGTTTACCAGTGTCCCTGTCCCGCATATTATTATCCCGTTAGATCATTTGTAATAGCCGTGGACTTTAAAGCGAGGCCACACAACGACCGTGCGAACGGCCGTTAACATGACATTTATGACATTTGGACAGGAAACCCCTAAGTAGGCAACACAGCAATTCGGAAT

Full Affymetrix probeset data:

Annotations for 1629591_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime