Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629592_at:

>probe:Drosophila_2:1629592_at:502:177; Interrogation_Position=1003; Antisense; AAACGATTCTACACCGTCTGCAATT
>probe:Drosophila_2:1629592_at:482:671; Interrogation_Position=1068; Antisense; TACGATGTCGTACCCATTCTAACAA
>probe:Drosophila_2:1629592_at:39:551; Interrogation_Position=1101; Antisense; GGAGTCGTCGATTGCTATCAGACAA
>probe:Drosophila_2:1629592_at:687:397; Interrogation_Position=1121; Antisense; GACAACGATTGTCTCCGAGGGAGTT
>probe:Drosophila_2:1629592_at:117:475; Interrogation_Position=1143; Antisense; GTTAGTGGCCTCTACAAGGGCTTTG
>probe:Drosophila_2:1629592_at:236:691; Interrogation_Position=1164; Antisense; TTTGGAGCCATGATCCTGCAGTTTG
>probe:Drosophila_2:1629592_at:288:357; Interrogation_Position=1191; Antisense; GCACACGTGGCCGTCATCAAATTGA
>probe:Drosophila_2:1629592_at:727:235; Interrogation_Position=1235; Antisense; AATCGTAGAGGTCATCTCCAACCGA
>probe:Drosophila_2:1629592_at:178:423; Interrogation_Position=1296; Antisense; GAGAATGCTTGCAACTCCAGGTCCA
>probe:Drosophila_2:1629592_at:101:393; Interrogation_Position=907; Antisense; GAAAGTATCAGGACACCACGCTGGA
>probe:Drosophila_2:1629592_at:138:109; Interrogation_Position=937; Antisense; AGAATGCGGACATCTATGCCAGCCT
>probe:Drosophila_2:1629592_at:24:313; Interrogation_Position=954; Antisense; GCCAGCCTTATTGCTATCATAACCA
>probe:Drosophila_2:1629592_at:326:659; Interrogation_Position=973; Antisense; TAACCACTGAGGTCATGTTCTTCCC
>probe:Drosophila_2:1629592_at:334:599; Interrogation_Position=988; Antisense; TGTTCTTCCCGTTCGAAACGATTCT

Paste this into a BLAST search page for me
AAACGATTCTACACCGTCTGCAATTTACGATGTCGTACCCATTCTAACAAGGAGTCGTCGATTGCTATCAGACAAGACAACGATTGTCTCCGAGGGAGTTGTTAGTGGCCTCTACAAGGGCTTTGTTTGGAGCCATGATCCTGCAGTTTGGCACACGTGGCCGTCATCAAATTGAAATCGTAGAGGTCATCTCCAACCGAGAGAATGCTTGCAACTCCAGGTCCAGAAAGTATCAGGACACCACGCTGGAAGAATGCGGACATCTATGCCAGCCTGCCAGCCTTATTGCTATCATAACCATAACCACTGAGGTCATGTTCTTCCCTGTTCTTCCCGTTCGAAACGATTCT

Full Affymetrix probeset data:

Annotations for 1629592_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime