FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629593_at:

>probe:Drosophila_2:1629593_at:700:397; Interrogation_Position=283; Antisense; GACAACTTTGTGGAGCTGACCCAGC
>probe:Drosophila_2:1629593_at:479:115; Interrogation_Position=305; Antisense; AGCATCCATTGCTGAAGGCCCTGGC
>probe:Drosophila_2:1629593_at:52:333; Interrogation_Position=346; Antisense; GCGGCCATTGGAGCACTCACGGGAA
>probe:Drosophila_2:1629593_at:321:131; Interrogation_Position=400; Antisense; ACCTCGCAGTTGTTCGGCTGGATAT
>probe:Drosophila_2:1629593_at:174:17; Interrogation_Position=427; Antisense; ATTTTCACCTGCTTCGTTGTGTCAT
>probe:Drosophila_2:1629593_at:716:41; Interrogation_Position=450; Antisense; ATCGTTCATTGACTTGGACCACTTT
>probe:Drosophila_2:1629593_at:276:573; Interrogation_Position=480; Antisense; GGCTCGTTCCCTTTATTTGGAGGAT
>probe:Drosophila_2:1629593_at:212:437; Interrogation_Position=499; Antisense; GAGGATGCCACCAATCTGTCGAAGA
>probe:Drosophila_2:1629593_at:155:683; Interrogation_Position=558; Antisense; TATGCTGCTGTTCTACATGTGCACC
>probe:Drosophila_2:1629593_at:72:63; Interrogation_Position=574; Antisense; ATGTGCACCGCCTGTTTGAACTATT
>probe:Drosophila_2:1629593_at:242:657; Interrogation_Position=611; Antisense; TAATGCTGGGATCCCTACTCTGTGC
>probe:Drosophila_2:1629593_at:405:679; Interrogation_Position=692; Antisense; TAGGTCACACGGACAGGATGCCCCA
>probe:Drosophila_2:1629593_at:377:117; Interrogation_Position=716; Antisense; AGCTAGCCTACATATTGACCACCAT
>probe:Drosophila_2:1629593_at:232:311; Interrogation_Position=857; Antisense; CCAACTATCGCTACATGCAGGTCTA

Paste this into a BLAST search page for me
GACAACTTTGTGGAGCTGACCCAGCAGCATCCATTGCTGAAGGCCCTGGCGCGGCCATTGGAGCACTCACGGGAAACCTCGCAGTTGTTCGGCTGGATATATTTTCACCTGCTTCGTTGTGTCATATCGTTCATTGACTTGGACCACTTTGGCTCGTTCCCTTTATTTGGAGGATGAGGATGCCACCAATCTGTCGAAGATATGCTGCTGTTCTACATGTGCACCATGTGCACCGCCTGTTTGAACTATTTAATGCTGGGATCCCTACTCTGTGCTAGGTCACACGGACAGGATGCCCCAAGCTAGCCTACATATTGACCACCATCCAACTATCGCTACATGCAGGTCTA

Full Affymetrix probeset data:

Annotations for 1629593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720