Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629596_s_at:

>probe:Drosophila_2:1629596_s_at:262:391; Interrogation_Position=111; Antisense; GAAACTGAATCTGAAGGCATCCCAG
>probe:Drosophila_2:1629596_s_at:450:237; Interrogation_Position=118; Antisense; AATCTGAAGGCATCCCAGTGGCGGC
>probe:Drosophila_2:1629596_s_at:452:613; Interrogation_Position=122; Antisense; TGAAGGCATCCCAGTGGCGGCGACA
>probe:Drosophila_2:1629596_s_at:594:581; Interrogation_Position=136; Antisense; TGGCGGCGACACACGGAATCCTTGC
>probe:Drosophila_2:1629596_s_at:199:325; Interrogation_Position=141; Antisense; GCGACACACGGAATCCTTGCCAAAT
>probe:Drosophila_2:1629596_s_at:700:157; Interrogation_Position=146; Antisense; ACACGGAATCCTTGCCAAATGCGGC
>probe:Drosophila_2:1629596_s_at:21:347; Interrogation_Position=15; Antisense; GCATCGTGACCGCTGCAACCACATT
>probe:Drosophila_2:1629596_s_at:678:367; Interrogation_Position=151; Antisense; GAATCCTTGCCAAATGCGGCCAAAT
>probe:Drosophila_2:1629596_s_at:308:167; Interrogation_Position=162; Antisense; AAATGCGGCCAAATGCGAGGCGCTG
>probe:Drosophila_2:1629596_s_at:469:637; Interrogation_Position=18; Antisense; TCGTGACCGCTGCAACCACATTGCA
>probe:Drosophila_2:1629596_s_at:141:263; Interrogation_Position=86; Antisense; CAGCAGCAAGGGAATCCGCACCGCT
>probe:Drosophila_2:1629596_s_at:151:223; Interrogation_Position=93; Antisense; AAGGGAATCCGCACCGCTGAAACTG
>probe:Drosophila_2:1629596_s_at:467:367; Interrogation_Position=97; Antisense; GAATCCGCACCGCTGAAACTGAATC
>probe:Drosophila_2:1629596_s_at:64:47; Interrogation_Position=99; Antisense; ATCCGCACCGCTGAAACTGAATCTG

Paste this into a BLAST search page for me
GAAACTGAATCTGAAGGCATCCCAGAATCTGAAGGCATCCCAGTGGCGGCTGAAGGCATCCCAGTGGCGGCGACATGGCGGCGACACACGGAATCCTTGCGCGACACACGGAATCCTTGCCAAATACACGGAATCCTTGCCAAATGCGGCGCATCGTGACCGCTGCAACCACATTGAATCCTTGCCAAATGCGGCCAAATAAATGCGGCCAAATGCGAGGCGCTGTCGTGACCGCTGCAACCACATTGCACAGCAGCAAGGGAATCCGCACCGCTAAGGGAATCCGCACCGCTGAAACTGGAATCCGCACCGCTGAAACTGAATCATCCGCACCGCTGAAACTGAATCTG

Full Affymetrix probeset data:

Annotations for 1629596_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime