Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629600_at:

>probe:Drosophila_2:1629600_at:190:701; Interrogation_Position=1747; Antisense; TTTTGCACATTTTCACGCAACCGTG
>probe:Drosophila_2:1629600_at:37:633; Interrogation_Position=1774; Antisense; TCCCGCCAGCAGCTATGTATTTTTT
>probe:Drosophila_2:1629600_at:565:699; Interrogation_Position=1794; Antisense; TTTTTAGTTCTATCCGCCATTGAGG
>probe:Drosophila_2:1629600_at:431:73; Interrogation_Position=1819; Antisense; AGGAAAACCCCTTATTGCTGCGCTG
>probe:Drosophila_2:1629600_at:720:333; Interrogation_Position=1845; Antisense; GCTGACACTGATCTTCCAATTTCGA
>probe:Drosophila_2:1629600_at:205:309; Interrogation_Position=1860; Antisense; CCAATTTCGAGAACCGTCTGTCCGG
>probe:Drosophila_2:1629600_at:540:305; Interrogation_Position=1890; Antisense; CCTTCTGAGCCCGTGTAAAATAATG
>probe:Drosophila_2:1629600_at:388:493; Interrogation_Position=1918; Antisense; GTAATCGTAGTTCCTTCTACGCGCA
>probe:Drosophila_2:1629600_at:200:485; Interrogation_Position=1997; Antisense; GTAGATACCTATGCGACGATCCGAG
>probe:Drosophila_2:1629600_at:404:635; Interrogation_Position=2039; Antisense; TCGACTTGAATTCTTGTGCTGCTGC
>probe:Drosophila_2:1629600_at:581:533; Interrogation_Position=2102; Antisense; GGTGGTCGCCTCATTGTATGTATAT
>probe:Drosophila_2:1629600_at:58:209; Interrogation_Position=2231; Antisense; AAGCACACAATCGTTTGCGTCACAC
>probe:Drosophila_2:1629600_at:514:723; Interrogation_Position=2245; Antisense; TTGCGTCACACACCTCAAGGTATTT
>probe:Drosophila_2:1629600_at:377:217; Interrogation_Position=2284; Antisense; AATCAAACGGTCTCCGATTTTCATA

Paste this into a BLAST search page for me
TTTTGCACATTTTCACGCAACCGTGTCCCGCCAGCAGCTATGTATTTTTTTTTTTAGTTCTATCCGCCATTGAGGAGGAAAACCCCTTATTGCTGCGCTGGCTGACACTGATCTTCCAATTTCGACCAATTTCGAGAACCGTCTGTCCGGCCTTCTGAGCCCGTGTAAAATAATGGTAATCGTAGTTCCTTCTACGCGCAGTAGATACCTATGCGACGATCCGAGTCGACTTGAATTCTTGTGCTGCTGCGGTGGTCGCCTCATTGTATGTATATAAGCACACAATCGTTTGCGTCACACTTGCGTCACACACCTCAAGGTATTTAATCAAACGGTCTCCGATTTTCATA

Full Affymetrix probeset data:

Annotations for 1629600_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime