Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629601_at:

>probe:Drosophila_2:1629601_at:80:353; Interrogation_Position=114; Antisense; GCAGCAGCAGAAGCCTCAGGGATCT
>probe:Drosophila_2:1629601_at:637:267; Interrogation_Position=130; Antisense; CAGGGATCTCTGGAATCGCTAGAAT
>probe:Drosophila_2:1629601_at:291:677; Interrogation_Position=149; Antisense; TAGAATCCGTCGACAATCTGCGCAA
>probe:Drosophila_2:1629601_at:613:193; Interrogation_Position=172; Antisense; AACGCCCAGGTTGAGGAGGCCTACT
>probe:Drosophila_2:1629601_at:73:549; Interrogation_Position=186; Antisense; GGAGGCCTACTATGCCGAGATCGAT
>probe:Drosophila_2:1629601_at:450:427; Interrogation_Position=202; Antisense; GAGATCGATGAGAACGCCGCCAACG
>probe:Drosophila_2:1629601_at:154:423; Interrogation_Position=226; Antisense; GAGAAGCTGGCCCAATTGGCTCACT
>probe:Drosophila_2:1629601_at:173:217; Interrogation_Position=23; Antisense; AAGTCGTTGTCGTCGCCAACACCAA
>probe:Drosophila_2:1629601_at:307:3; Interrogation_Position=240; Antisense; ATTGGCTCACTCTCAGGAGTTCGAG
>probe:Drosophila_2:1629601_at:472:549; Interrogation_Position=288; Antisense; GGAGGATGTCTATGTCCCAGTTCGC
>probe:Drosophila_2:1629601_at:2:315; Interrogation_Position=382; Antisense; GCCATGTGCTACTCCATGCAATTCC
>probe:Drosophila_2:1629601_at:692:361; Interrogation_Position=399; Antisense; GCAATTCCAGGATCGTTGGGCCCAG
>probe:Drosophila_2:1629601_at:523:117; Interrogation_Position=64; Antisense; AGCTACAGCATCAAGCAGGTCCTGA
>probe:Drosophila_2:1629601_at:432:349; Interrogation_Position=78; Antisense; GCAGGTCCTGAAGACGCTCTTCAAG

Paste this into a BLAST search page for me
GCAGCAGCAGAAGCCTCAGGGATCTCAGGGATCTCTGGAATCGCTAGAATTAGAATCCGTCGACAATCTGCGCAAAACGCCCAGGTTGAGGAGGCCTACTGGAGGCCTACTATGCCGAGATCGATGAGATCGATGAGAACGCCGCCAACGGAGAAGCTGGCCCAATTGGCTCACTAAGTCGTTGTCGTCGCCAACACCAAATTGGCTCACTCTCAGGAGTTCGAGGGAGGATGTCTATGTCCCAGTTCGCGCCATGTGCTACTCCATGCAATTCCGCAATTCCAGGATCGTTGGGCCCAGAGCTACAGCATCAAGCAGGTCCTGAGCAGGTCCTGAAGACGCTCTTCAAG

Full Affymetrix probeset data:

Annotations for 1629601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime