FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629602_at:

>probe:Drosophila_2:1629602_at:39:681; Interrogation_Position=1788; Antisense; TATGTGAATCCCCAAAAGCTGAAAG
>probe:Drosophila_2:1629602_at:18:429; Interrogation_Position=1812; Antisense; GAGATACGTTGATTGTTTCCAGTAG
>probe:Drosophila_2:1629602_at:494:475; Interrogation_Position=1868; Antisense; GTTAGCCAATGAATTCGCCCATGTA
>probe:Drosophila_2:1629602_at:538:507; Interrogation_Position=1919; Antisense; GTGCGATATAGTGCACCCATATTTG
>probe:Drosophila_2:1629602_at:181:261; Interrogation_Position=1932; Antisense; CACCCATATTTGTTGGAAGCCATAC
>probe:Drosophila_2:1629602_at:573:689; Interrogation_Position=1966; Antisense; TATTGATCTTTGCTGTTCCATATGC
>probe:Drosophila_2:1629602_at:133:345; Interrogation_Position=1995; Antisense; GCATAGCTTTTTGCATGTTACCAAC
>probe:Drosophila_2:1629602_at:315:3; Interrogation_Position=2180; Antisense; ATTGTCGGCCAAACGGACACGTCGG
>probe:Drosophila_2:1629602_at:45:261; Interrogation_Position=2197; Antisense; CACGTCGGTCGCATGGTCGATGGAA
>probe:Drosophila_2:1629602_at:315:117; Interrogation_Position=2236; Antisense; AGCTTCCATGGGACTTCGTGCACCT
>probe:Drosophila_2:1629602_at:439:507; Interrogation_Position=2253; Antisense; GTGCACCTTCGGATATTGGCGCTAC
>probe:Drosophila_2:1629602_at:636:729; Interrogation_Position=2268; Antisense; TTGGCGCTACCTTATCGATATTGAT
>probe:Drosophila_2:1629602_at:557:459; Interrogation_Position=2284; Antisense; GATATTGATGTGCTTTGTTCACCCA
>probe:Drosophila_2:1629602_at:96:603; Interrogation_Position=2299; Antisense; TGTTCACCCATATCTACTGTACTGT

Paste this into a BLAST search page for me
TATGTGAATCCCCAAAAGCTGAAAGGAGATACGTTGATTGTTTCCAGTAGGTTAGCCAATGAATTCGCCCATGTAGTGCGATATAGTGCACCCATATTTGCACCCATATTTGTTGGAAGCCATACTATTGATCTTTGCTGTTCCATATGCGCATAGCTTTTTGCATGTTACCAACATTGTCGGCCAAACGGACACGTCGGCACGTCGGTCGCATGGTCGATGGAAAGCTTCCATGGGACTTCGTGCACCTGTGCACCTTCGGATATTGGCGCTACTTGGCGCTACCTTATCGATATTGATGATATTGATGTGCTTTGTTCACCCATGTTCACCCATATCTACTGTACTGT

Full Affymetrix probeset data:

Annotations for 1629602_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720