Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629603_at:

>probe:Drosophila_2:1629603_at:295:217; Interrogation_Position=1988; Antisense; AAGTTCATGTCCCAAGTCGTTCAGC
>probe:Drosophila_2:1629603_at:474:613; Interrogation_Position=2041; Antisense; TGAACTGGCTCTGGAACAGTCGCGT
>probe:Drosophila_2:1629603_at:524:539; Interrogation_Position=2073; Antisense; GGTTGGCCCTGCGAGGATATTCCCA
>probe:Drosophila_2:1629603_at:157:459; Interrogation_Position=2088; Antisense; GATATTCCCATCTGGGCGGCAGCAT
>probe:Drosophila_2:1629603_at:574:565; Interrogation_Position=2105; Antisense; GGCAGCATCAAGGACACCTTCTTTG
>probe:Drosophila_2:1629603_at:127:401; Interrogation_Position=2261; Antisense; GACATCGTGTATTTCGTTCTGCCAT
>probe:Drosophila_2:1629603_at:86:713; Interrogation_Position=2286; Antisense; TTGGAAACCACATCCTCAAGGACTG
>probe:Drosophila_2:1629603_at:147:407; Interrogation_Position=2306; Antisense; GACTGGTTCCACATGACAGATCGAA
>probe:Drosophila_2:1629603_at:325:53; Interrogation_Position=2335; Antisense; ATGCATGTCCATGGTTTTCGTTCTG
>probe:Drosophila_2:1629603_at:564:273; Interrogation_Position=2374; Antisense; CATTACATTCTCTGGTTTTGCATAT
>probe:Drosophila_2:1629603_at:146:349; Interrogation_Position=2416; Antisense; GCATGATCTGCTTAGTGGCTACTAC
>probe:Drosophila_2:1629603_at:729:395; Interrogation_Position=2460; Antisense; GAAATTTGTCATTCGCCATTGCGGC
>probe:Drosophila_2:1629603_at:48:275; Interrogation_Position=2476; Antisense; CATTGCGGCCGACTACTTATGTAAA
>probe:Drosophila_2:1629603_at:484:605; Interrogation_Position=2532; Antisense; TGATGCCCAACTAAAACGCCACGGA

Paste this into a BLAST search page for me
AAGTTCATGTCCCAAGTCGTTCAGCTGAACTGGCTCTGGAACAGTCGCGTGGTTGGCCCTGCGAGGATATTCCCAGATATTCCCATCTGGGCGGCAGCATGGCAGCATCAAGGACACCTTCTTTGGACATCGTGTATTTCGTTCTGCCATTTGGAAACCACATCCTCAAGGACTGGACTGGTTCCACATGACAGATCGAAATGCATGTCCATGGTTTTCGTTCTGCATTACATTCTCTGGTTTTGCATATGCATGATCTGCTTAGTGGCTACTACGAAATTTGTCATTCGCCATTGCGGCCATTGCGGCCGACTACTTATGTAAATGATGCCCAACTAAAACGCCACGGA

Full Affymetrix probeset data:

Annotations for 1629603_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime