FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629605_at:

>probe:Drosophila_2:1629605_at:144:655; Interrogation_Position=1019; Antisense; TAACTTTTCTTGAGACGCTGGACCT
>probe:Drosophila_2:1629605_at:5:265; Interrogation_Position=1044; Antisense; CAGCAATTCACCCTATATCACTAAT
>probe:Drosophila_2:1629605_at:55:437; Interrogation_Position=1069; Antisense; GAGGTTGTCATCGAACTGGTCATAG
>probe:Drosophila_2:1629605_at:658:677; Interrogation_Position=1091; Antisense; TAGGAATTCCCAACCTTAGTGTGTT
>probe:Drosophila_2:1629605_at:128:599; Interrogation_Position=1129; Antisense; TGTCCTCTGCTCACAAATCGTGTAT
>probe:Drosophila_2:1629605_at:639:685; Interrogation_Position=757; Antisense; TATAGGCTGGGTGAGCTGCGCTATC
>probe:Drosophila_2:1629605_at:470:341; Interrogation_Position=776; Antisense; GCTATCTGCAGTCGTTGGTCATTAA
>probe:Drosophila_2:1629605_at:441:663; Interrogation_Position=798; Antisense; TAAAGCTCACTCCACAGACACAATT
>probe:Drosophila_2:1629605_at:678:113; Interrogation_Position=835; Antisense; AGCGACTGGATGCTGATTTCCCTAT
>probe:Drosophila_2:1629605_at:204:5; Interrogation_Position=858; Antisense; ATTGGATGTGCCCTTTCTGCGAAAC
>probe:Drosophila_2:1629605_at:676:605; Interrogation_Position=884; Antisense; TGATGTTTTCAGATGCACCGAGTGG
>probe:Drosophila_2:1629605_at:279:261; Interrogation_Position=899; Antisense; CACCGAGTGGCTTTGTTAGCGCAAA
>probe:Drosophila_2:1629605_at:674:123; Interrogation_Position=916; Antisense; AGCGCAAATGCCCTGTCGATTATAT
>probe:Drosophila_2:1629605_at:90:119; Interrogation_Position=953; Antisense; AGCTGCGTGTTCTGAAAATGCCGAA

Paste this into a BLAST search page for me
TAACTTTTCTTGAGACGCTGGACCTCAGCAATTCACCCTATATCACTAATGAGGTTGTCATCGAACTGGTCATAGTAGGAATTCCCAACCTTAGTGTGTTTGTCCTCTGCTCACAAATCGTGTATTATAGGCTGGGTGAGCTGCGCTATCGCTATCTGCAGTCGTTGGTCATTAATAAAGCTCACTCCACAGACACAATTAGCGACTGGATGCTGATTTCCCTATATTGGATGTGCCCTTTCTGCGAAACTGATGTTTTCAGATGCACCGAGTGGCACCGAGTGGCTTTGTTAGCGCAAAAGCGCAAATGCCCTGTCGATTATATAGCTGCGTGTTCTGAAAATGCCGAA

Full Affymetrix probeset data:

Annotations for 1629605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720