FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629606_at:

>probe:Drosophila_2:1629606_at:76:505; Interrogation_Position=1060; Antisense; GTGCCTTTTGCACCATAACCATAGG
>probe:Drosophila_2:1629606_at:136:79; Interrogation_Position=1082; Antisense; AGGTTAATCTCTTGCACTATCTGTG
>probe:Drosophila_2:1629606_at:432:133; Interrogation_Position=1161; Antisense; ACGCCACCTACCTGTTTGTGAATGA
>probe:Drosophila_2:1629606_at:654:299; Interrogation_Position=654; Antisense; CGCCCAGGAGGCATATCAGTTCAAC
>probe:Drosophila_2:1629606_at:56:475; Interrogation_Position=672; Antisense; GTTCAACTTTGTTTCGAGGATCTTC
>probe:Drosophila_2:1629606_at:687:435; Interrogation_Position=687; Antisense; GAGGATCTTCAAGGCCAGCGAATTG
>probe:Drosophila_2:1629606_at:683:587; Interrogation_Position=710; Antisense; TGGAGTCGGTGATTTGGCCCAAATT
>probe:Drosophila_2:1629606_at:219:319; Interrogation_Position=726; Antisense; GCCCAAATTGCGTCAGTATTCCGAG
>probe:Drosophila_2:1629606_at:274:561; Interrogation_Position=776; Antisense; GGAAACGCCTCGTCAAGGATGGCTT
>probe:Drosophila_2:1629606_at:265:441; Interrogation_Position=793; Antisense; GATGGCTTCCTGGAGAATCTCATCA
>probe:Drosophila_2:1629606_at:206:479; Interrogation_Position=870; Antisense; GTTTGCCCAGGCCATCATAGACTTT
>probe:Drosophila_2:1629606_at:154:35; Interrogation_Position=883; Antisense; ATCATAGACTTTGCCAGCCGTAAAA
>probe:Drosophila_2:1629606_at:198:571; Interrogation_Position=929; Antisense; GGCTTAAGTTTATTACCGTCTCAGT
>probe:Drosophila_2:1629606_at:215:267; Interrogation_Position=950; Antisense; CAGTGATTTTGTCCGCCTATTTTAA

Paste this into a BLAST search page for me
GTGCCTTTTGCACCATAACCATAGGAGGTTAATCTCTTGCACTATCTGTGACGCCACCTACCTGTTTGTGAATGACGCCCAGGAGGCATATCAGTTCAACGTTCAACTTTGTTTCGAGGATCTTCGAGGATCTTCAAGGCCAGCGAATTGTGGAGTCGGTGATTTGGCCCAAATTGCCCAAATTGCGTCAGTATTCCGAGGGAAACGCCTCGTCAAGGATGGCTTGATGGCTTCCTGGAGAATCTCATCAGTTTGCCCAGGCCATCATAGACTTTATCATAGACTTTGCCAGCCGTAAAAGGCTTAAGTTTATTACCGTCTCAGTCAGTGATTTTGTCCGCCTATTTTAA

Full Affymetrix probeset data:

Annotations for 1629606_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720