Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629607_at:

>probe:Drosophila_2:1629607_at:113:177; Interrogation_Position=1236; Antisense; AAACCGCTGCGAGTCAAGGATCTGA
>probe:Drosophila_2:1629607_at:730:91; Interrogation_Position=1270; Antisense; AGTTCACGCTGCTCAAGGACGGCGA
>probe:Drosophila_2:1629607_at:525:157; Interrogation_Position=1294; Antisense; ACACGAAGCGCTCGCTGATTGCCAA
>probe:Drosophila_2:1629607_at:617:603; Interrogation_Position=1309; Antisense; TGATTGCCAAGGAGGCGCGCTACAT
>probe:Drosophila_2:1629607_at:443:339; Interrogation_Position=1454; Antisense; GCTCACGGATCGCAAGCTCAAGGAG
>probe:Drosophila_2:1629607_at:345:551; Interrogation_Position=1475; Antisense; GGAGAAGGACATCATTCCCCTGCAG
>probe:Drosophila_2:1629607_at:566:351; Interrogation_Position=1507; Antisense; GCACTGGCTACGCAACGACGAACGA
>probe:Drosophila_2:1629607_at:134:271; Interrogation_Position=1559; Antisense; CATGCTCCAGGCCTAAGACGAATTT
>probe:Drosophila_2:1629607_at:56:411; Interrogation_Position=1575; Antisense; GACGAATTTATATAGCCGCCAGCTA
>probe:Drosophila_2:1629607_at:434:299; Interrogation_Position=1591; Antisense; CGCCAGCTACTTGGGAGCACTTCAA
>probe:Drosophila_2:1629607_at:235:231; Interrogation_Position=1620; Antisense; AATGTAATCGTTTTAGCACTAGCTA
>probe:Drosophila_2:1629607_at:593:679; Interrogation_Position=1718; Antisense; TATCTGTTCCAATTCTACCTTTTCG
>probe:Drosophila_2:1629607_at:649:643; Interrogation_Position=1731; Antisense; TCTACCTTTTCGTTTATTGCAAGAC
>probe:Drosophila_2:1629607_at:433:241; Interrogation_Position=1799; Antisense; AATACACTGATACTCGTACCACACA

Paste this into a BLAST search page for me
AAACCGCTGCGAGTCAAGGATCTGAAGTTCACGCTGCTCAAGGACGGCGAACACGAAGCGCTCGCTGATTGCCAATGATTGCCAAGGAGGCGCGCTACATGCTCACGGATCGCAAGCTCAAGGAGGGAGAAGGACATCATTCCCCTGCAGGCACTGGCTACGCAACGACGAACGACATGCTCCAGGCCTAAGACGAATTTGACGAATTTATATAGCCGCCAGCTACGCCAGCTACTTGGGAGCACTTCAAAATGTAATCGTTTTAGCACTAGCTATATCTGTTCCAATTCTACCTTTTCGTCTACCTTTTCGTTTATTGCAAGACAATACACTGATACTCGTACCACACA

Full Affymetrix probeset data:

Annotations for 1629607_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime