Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629609_at:

>probe:Drosophila_2:1629609_at:5:531; Interrogation_Position=2039; Antisense; GGGTTAAGATAGTTCATTTGCGTTA
>probe:Drosophila_2:1629609_at:191:377; Interrogation_Position=2066; Antisense; GAAGAATTGCATCATATCTCCCACT
>probe:Drosophila_2:1629609_at:581:361; Interrogation_Position=2069; Antisense; GAATTGCATCATATCTCCCACTTTA
>probe:Drosophila_2:1629609_at:157:725; Interrogation_Position=2072; Antisense; TTGCATCATATCTCCCACTTTAAAG
>probe:Drosophila_2:1629609_at:536:23; Interrogation_Position=2079; Antisense; ATATCTCCCACTTTAAAGCCCATTT
>probe:Drosophila_2:1629609_at:377:629; Interrogation_Position=2084; Antisense; TCCCACTTTAAAGCCCATTTCTAGG
>probe:Drosophila_2:1629609_at:275:709; Interrogation_Position=2091; Antisense; TTAAAGCCCATTTCTAGGCCGCAAT
>probe:Drosophila_2:1629609_at:339:125; Interrogation_Position=2095; Antisense; AGCCCATTTCTAGGCCGCAATTCAT
>probe:Drosophila_2:1629609_at:70:645; Interrogation_Position=2103; Antisense; TCTAGGCCGCAATTCATTTGATGTC
>probe:Drosophila_2:1629609_at:548:577; Interrogation_Position=2107; Antisense; GGCCGCAATTCATTTGATGTCAACA
>probe:Drosophila_2:1629609_at:107:693; Interrogation_Position=2119; Antisense; TTTGATGTCAACACATCTGGTCATC
>probe:Drosophila_2:1629609_at:660:537; Interrogation_Position=2137; Antisense; GGTCATCAGCCAGAGAGTCTTAACA
>probe:Drosophila_2:1629609_at:447:313; Interrogation_Position=2145; Antisense; GCCAGAGAGTCTTAACAAATATATA
>probe:Drosophila_2:1629609_at:32:683; Interrogation_Position=2168; Antisense; TATCATTTCAGATGTGGCGACTCCA

Paste this into a BLAST search page for me
GGGTTAAGATAGTTCATTTGCGTTAGAAGAATTGCATCATATCTCCCACTGAATTGCATCATATCTCCCACTTTATTGCATCATATCTCCCACTTTAAAGATATCTCCCACTTTAAAGCCCATTTTCCCACTTTAAAGCCCATTTCTAGGTTAAAGCCCATTTCTAGGCCGCAATAGCCCATTTCTAGGCCGCAATTCATTCTAGGCCGCAATTCATTTGATGTCGGCCGCAATTCATTTGATGTCAACATTTGATGTCAACACATCTGGTCATCGGTCATCAGCCAGAGAGTCTTAACAGCCAGAGAGTCTTAACAAATATATATATCATTTCAGATGTGGCGACTCCA

Full Affymetrix probeset data:

Annotations for 1629609_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime