FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629610_at:

>probe:Drosophila_2:1629610_at:720:625; Interrogation_Position=1028; Antisense; TGCCCGATCTGGATGCACTGATAGA
>probe:Drosophila_2:1629610_at:56:25; Interrogation_Position=1048; Antisense; ATAGATCTGCCCTATCTGAGTGCCT
>probe:Drosophila_2:1629610_at:642:573; Interrogation_Position=1108; Antisense; GGCTGGGCATCAAAGACCTGCACAA
>probe:Drosophila_2:1629610_at:640:33; Interrogation_Position=1157; Antisense; ATCACTCGGAACCTCTGAAGCTGAG
>probe:Drosophila_2:1629610_at:374:671; Interrogation_Position=1210; Antisense; TACGCTCTGCACAATGATCCGGATC
>probe:Drosophila_2:1629610_at:511:171; Interrogation_Position=1265; Antisense; AAAGATTCCTCGACGGCGGTCTGAA
>probe:Drosophila_2:1629610_at:181:267; Interrogation_Position=1303; Antisense; CAGGGCATCTTTCTGGGATTCGGAA
>probe:Drosophila_2:1629610_at:546:627; Interrogation_Position=1389; Antisense; TGCCATTGTCCAGCGATTCGAGGTC
>probe:Drosophila_2:1629610_at:332:567; Interrogation_Position=1438; Antisense; GGCACAGAGTTAGATCCCCTGATCT
>probe:Drosophila_2:1629610_at:128:161; Interrogation_Position=1475; Antisense; ACAAGGGCGGCATTTGGCTGCAGTT
>probe:Drosophila_2:1629610_at:306:573; Interrogation_Position=1490; Antisense; GGCTGCAGTTCGTTCCACGGAAAAA
>probe:Drosophila_2:1629610_at:473:291; Interrogation_Position=964; Antisense; CGTAATCCAGATTGCCAGCGGCGTT
>probe:Drosophila_2:1629610_at:50:121; Interrogation_Position=980; Antisense; AGCGGCGTTTGTACGAGGAACTCCA
>probe:Drosophila_2:1629610_at:35:73; Interrogation_Position=995; Antisense; AGGAACTCCAGTTGGTCAATCCCGG

Paste this into a BLAST search page for me
TGCCCGATCTGGATGCACTGATAGAATAGATCTGCCCTATCTGAGTGCCTGGCTGGGCATCAAAGACCTGCACAAATCACTCGGAACCTCTGAAGCTGAGTACGCTCTGCACAATGATCCGGATCAAAGATTCCTCGACGGCGGTCTGAACAGGGCATCTTTCTGGGATTCGGAATGCCATTGTCCAGCGATTCGAGGTCGGCACAGAGTTAGATCCCCTGATCTACAAGGGCGGCATTTGGCTGCAGTTGGCTGCAGTTCGTTCCACGGAAAAACGTAATCCAGATTGCCAGCGGCGTTAGCGGCGTTTGTACGAGGAACTCCAAGGAACTCCAGTTGGTCAATCCCGG

Full Affymetrix probeset data:

Annotations for 1629610_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720