FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629612_at:

>probe:Drosophila_2:1629612_at:248:5; Interrogation_Position=140; Antisense; ATTGCGGAGCGGCTTTCGGATTGAG
>probe:Drosophila_2:1629612_at:358:717; Interrogation_Position=154; Antisense; TTCGGATTGAGTGAGAGCCATGGAC
>probe:Drosophila_2:1629612_at:154:425; Interrogation_Position=166; Antisense; GAGAGCCATGGACTCCAAGTGTCTG
>probe:Drosophila_2:1629612_at:525:65; Interrogation_Position=173; Antisense; ATGGACTCCAAGTGTCTGGCTCCAA
>probe:Drosophila_2:1629612_at:647:11; Interrogation_Position=219; Antisense; ATTACAACTACACCGCGCCACGGGT
>probe:Drosophila_2:1629612_at:163:321; Interrogation_Position=233; Antisense; GCGCCACGGGTCTCAACATTTTTTC
>probe:Drosophila_2:1629612_at:15:151; Interrogation_Position=248; Antisense; ACATTTTTTCCGTTGAGTGCGTCAC
>probe:Drosophila_2:1629612_at:295:631; Interrogation_Position=256; Antisense; TCCGTTGAGTGCGTCACTTGTGACG
>probe:Drosophila_2:1629612_at:102:149; Interrogation_Position=271; Antisense; ACTTGTGACGCCCACGTGGCAAGCG
>probe:Drosophila_2:1629612_at:160:585; Interrogation_Position=287; Antisense; TGGCAAGCGGACTGGCTGGCTTCAC
>probe:Drosophila_2:1629612_at:134:141; Interrogation_Position=297; Antisense; ACTGGCTGGCTTCACCTTCTGCCTG
>probe:Drosophila_2:1629612_at:723:303; Interrogation_Position=326; Antisense; CCTGCCTCAACATTGATTTTCTGGG
>probe:Drosophila_2:1629612_at:16:275; Interrogation_Position=336; Antisense; CATTGATTTTCTGGGTTCTGGGCGC
>probe:Drosophila_2:1629612_at:199:699; Interrogation_Position=342; Antisense; TTTTCTGGGTTCTGGGCGCTCCGGC

Paste this into a BLAST search page for me
ATTGCGGAGCGGCTTTCGGATTGAGTTCGGATTGAGTGAGAGCCATGGACGAGAGCCATGGACTCCAAGTGTCTGATGGACTCCAAGTGTCTGGCTCCAAATTACAACTACACCGCGCCACGGGTGCGCCACGGGTCTCAACATTTTTTCACATTTTTTCCGTTGAGTGCGTCACTCCGTTGAGTGCGTCACTTGTGACGACTTGTGACGCCCACGTGGCAAGCGTGGCAAGCGGACTGGCTGGCTTCACACTGGCTGGCTTCACCTTCTGCCTGCCTGCCTCAACATTGATTTTCTGGGCATTGATTTTCTGGGTTCTGGGCGCTTTTCTGGGTTCTGGGCGCTCCGGC

Full Affymetrix probeset data:

Annotations for 1629612_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720