Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629613_at:

>probe:Drosophila_2:1629613_at:471:367; Interrogation_Position=2926; Antisense; GAATCGGCAGAGATTGCCCTGCTGC
>probe:Drosophila_2:1629613_at:634:619; Interrogation_Position=2945; Antisense; TGCTGCTGCGCGAGTGCATCTGGAA
>probe:Drosophila_2:1629613_at:36:683; Interrogation_Position=2971; Antisense; TATCTTAAAGATCACGTGCCCTCGC
>probe:Drosophila_2:1629613_at:457:287; Interrogation_Position=2996; Antisense; CGGCGCTGTTTCACGTGGACAACAA
>probe:Drosophila_2:1629613_at:660:159; Interrogation_Position=3014; Antisense; ACAACAACGGGCTGCACTGGCGCAA
>probe:Drosophila_2:1629613_at:708:183; Interrogation_Position=3037; Antisense; AACACGAATACACAGCTGGCCAAGG
>probe:Drosophila_2:1629613_at:675:219; Interrogation_Position=3058; Antisense; AAGGTGCCGCCGCAATATGTGGACC
>probe:Drosophila_2:1629613_at:513:469; Interrogation_Position=3084; Antisense; GTTGCGCCACCTAATGCAGCGTAAG
>probe:Drosophila_2:1629613_at:58:435; Interrogation_Position=3163; Antisense; GAGGGCGACTCAGAGCCAGATCCGA
>probe:Drosophila_2:1629613_at:440:321; Interrogation_Position=3190; Antisense; GCCCGGCTGCAGATCGTTGAAATAG
>probe:Drosophila_2:1629613_at:268:661; Interrogation_Position=3403; Antisense; TAAAATCTCAACCTAGGCCTTGCAA
>probe:Drosophila_2:1629613_at:351:579; Interrogation_Position=3418; Antisense; GGCCTTGCAAATACTGTCCAGCAGT
>probe:Drosophila_2:1629613_at:237:115; Interrogation_Position=3437; Antisense; AGCAGTTATTGTACCGACGGCGCCT
>probe:Drosophila_2:1629613_at:393:165; Interrogation_Position=3464; Antisense; AAATCGCATCATTCGTCGTGTGTAG

Paste this into a BLAST search page for me
GAATCGGCAGAGATTGCCCTGCTGCTGCTGCTGCGCGAGTGCATCTGGAATATCTTAAAGATCACGTGCCCTCGCCGGCGCTGTTTCACGTGGACAACAAACAACAACGGGCTGCACTGGCGCAAAACACGAATACACAGCTGGCCAAGGAAGGTGCCGCCGCAATATGTGGACCGTTGCGCCACCTAATGCAGCGTAAGGAGGGCGACTCAGAGCCAGATCCGAGCCCGGCTGCAGATCGTTGAAATAGTAAAATCTCAACCTAGGCCTTGCAAGGCCTTGCAAATACTGTCCAGCAGTAGCAGTTATTGTACCGACGGCGCCTAAATCGCATCATTCGTCGTGTGTAG

Full Affymetrix probeset data:

Annotations for 1629613_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime