FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629614_at:

>probe:Drosophila_2:1629614_at:324:521; Interrogation_Position=1009; Antisense; GTGGCATTTATCGAATTTAGCGTCA
>probe:Drosophila_2:1629614_at:86:461; Interrogation_Position=1100; Antisense; GATTTCTTGGATTTTTCCTCTCATA
>probe:Drosophila_2:1629614_at:350:613; Interrogation_Position=551; Antisense; TGAACACCAATGTGCGTTCCCTGTA
>probe:Drosophila_2:1629614_at:54:581; Interrogation_Position=590; Antisense; TGGCCACTCCAGAGCTAGTCAAGAC
>probe:Drosophila_2:1629614_at:558:39; Interrogation_Position=625; Antisense; ATCGTAAACGTATCCAGTGTCTGTG
>probe:Drosophila_2:1629614_at:361:85; Interrogation_Position=640; Antisense; AGTGTCTGTGGACTGCGTGCCTTTC
>probe:Drosophila_2:1629614_at:339:515; Interrogation_Position=668; Antisense; GTGTCCTGGCCTACAATGTGTCTAA
>probe:Drosophila_2:1629614_at:124:521; Interrogation_Position=700; Antisense; GTGGACCAGTTCACGGCCTGCATAG
>probe:Drosophila_2:1629614_at:43:77; Interrogation_Position=744; Antisense; AGGAGTCCGCGTAAACGCCGTGAAT
>probe:Drosophila_2:1629614_at:531:45; Interrogation_Position=767; Antisense; ATCCCGGCGTGATTGTGACTGACAT
>probe:Drosophila_2:1629614_at:112:283; Interrogation_Position=785; Antisense; CTGACATTCACAAGCGTGGCGGCAT
>probe:Drosophila_2:1629614_at:271:551; Interrogation_Position=816; Antisense; GGAGACCTATGCCAAGTTCCTCGAA
>probe:Drosophila_2:1629614_at:477:69; Interrogation_Position=923; Antisense; AGGCCAGCTTCACCACGGGAATCAG
>probe:Drosophila_2:1629614_at:374:525; Interrogation_Position=939; Antisense; GGGAATCAGTCTGCCCGTCGATGGA

Paste this into a BLAST search page for me
GTGGCATTTATCGAATTTAGCGTCAGATTTCTTGGATTTTTCCTCTCATATGAACACCAATGTGCGTTCCCTGTATGGCCACTCCAGAGCTAGTCAAGACATCGTAAACGTATCCAGTGTCTGTGAGTGTCTGTGGACTGCGTGCCTTTCGTGTCCTGGCCTACAATGTGTCTAAGTGGACCAGTTCACGGCCTGCATAGAGGAGTCCGCGTAAACGCCGTGAATATCCCGGCGTGATTGTGACTGACATCTGACATTCACAAGCGTGGCGGCATGGAGACCTATGCCAAGTTCCTCGAAAGGCCAGCTTCACCACGGGAATCAGGGGAATCAGTCTGCCCGTCGATGGA

Full Affymetrix probeset data:

Annotations for 1629614_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720