FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629615_at:

>probe:Drosophila_2:1629615_at:716:359; Interrogation_Position=220; Antisense; GAATTCTTGGCTCTCGGGTTTAAGA
>probe:Drosophila_2:1629615_at:555:317; Interrogation_Position=250; Antisense; GCCGAATTTCAGAGGGCAGCTATTA
>probe:Drosophila_2:1629615_at:295:257; Interrogation_Position=282; Antisense; CACAACTCGCAGTTTGTCCATCAGT
>probe:Drosophila_2:1629615_at:618:725; Interrogation_Position=295; Antisense; TTGTCCATCAGTCGTGGTCGAACAC
>probe:Drosophila_2:1629615_at:28:535; Interrogation_Position=310; Antisense; GGTCGAACACGAACTCCGCAGAATG
>probe:Drosophila_2:1629615_at:451:399; Interrogation_Position=367; Antisense; GACAGGGCTCTGAGTGGCGACACCA
>probe:Drosophila_2:1629615_at:635:83; Interrogation_Position=379; Antisense; AGTGGCGACACCATGAGCTTTGTGC
>probe:Drosophila_2:1629615_at:163:99; Interrogation_Position=461; Antisense; AGATGCGTCCGGATCGCTATGCGGA
>probe:Drosophila_2:1629615_at:686:513; Interrogation_Position=511; Antisense; GTGATCACCGTGAAACCGCACAAGA
>probe:Drosophila_2:1629615_at:1:447; Interrogation_Position=561; Antisense; GATGCAGCTGGATGAGAACACACTC
>probe:Drosophila_2:1629615_at:274:399; Interrogation_Position=597; Antisense; GACACTGAATGCCAATCTCGGATTA
>probe:Drosophila_2:1629615_at:84:295; Interrogation_Position=69; Antisense; CGAAGAGAAAGTGCGCCTGTCCCAA
>probe:Drosophila_2:1629615_at:442:507; Interrogation_Position=79; Antisense; GTGCGCCTGTCCCAAATCAAAATGG
>probe:Drosophila_2:1629615_at:77:35; Interrogation_Position=94; Antisense; ATCAAAATGGATTCGGCTCTGGAGA

Paste this into a BLAST search page for me
GAATTCTTGGCTCTCGGGTTTAAGAGCCGAATTTCAGAGGGCAGCTATTACACAACTCGCAGTTTGTCCATCAGTTTGTCCATCAGTCGTGGTCGAACACGGTCGAACACGAACTCCGCAGAATGGACAGGGCTCTGAGTGGCGACACCAAGTGGCGACACCATGAGCTTTGTGCAGATGCGTCCGGATCGCTATGCGGAGTGATCACCGTGAAACCGCACAAGAGATGCAGCTGGATGAGAACACACTCGACACTGAATGCCAATCTCGGATTACGAAGAGAAAGTGCGCCTGTCCCAAGTGCGCCTGTCCCAAATCAAAATGGATCAAAATGGATTCGGCTCTGGAGA

Full Affymetrix probeset data:

Annotations for 1629615_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720