FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629618_at:

>probe:Drosophila_2:1629618_at:316:625; Interrogation_Position=210; Antisense; TGCCCACTGCGTCAATGGCCAGAAT
>probe:Drosophila_2:1629618_at:230:369; Interrogation_Position=231; Antisense; GAATGCCAGTCGAATTAGCGTAGTT
>probe:Drosophila_2:1629618_at:704:81; Interrogation_Position=265; Antisense; AGGGATCTCAACGATAGCTCCGGCT
>probe:Drosophila_2:1629618_at:445:341; Interrogation_Position=287; Antisense; GCTTCCGATCGCAGGTGCAGTCGTA
>probe:Drosophila_2:1629618_at:78:533; Interrogation_Position=339; Antisense; GGTGACTAGTGACATTGCCATCCTC
>probe:Drosophila_2:1629618_at:334:137; Interrogation_Position=389; Antisense; ACGAGAAGCGTGTGTCCACCATCGA
>probe:Drosophila_2:1629618_at:66:681; Interrogation_Position=434; Antisense; TAGGTGCCGATCAGGAGGTTCTCCT
>probe:Drosophila_2:1629618_at:310:541; Interrogation_Position=469; Antisense; GGTTCTGTCTTCCACTTTGGCACAG
>probe:Drosophila_2:1629618_at:32:585; Interrogation_Position=486; Antisense; TGGCACAGGTCCTTTCGCCAAATAT
>probe:Drosophila_2:1629618_at:604:163; Interrogation_Position=505; Antisense; AAATATCCCACTGTACTCCAGAAAC
>probe:Drosophila_2:1629618_at:363:423; Interrogation_Position=565; Antisense; GAGACGATGACCCAGCTGACGGACA
>probe:Drosophila_2:1629618_at:419:295; Interrogation_Position=674; Antisense; CCTATAAACAGGTGGGCGTCGTCTC
>probe:Drosophila_2:1629618_at:216:67; Interrogation_Position=701; Antisense; ATGGAACTGCATTCTGTGCCTCGAA
>probe:Drosophila_2:1629618_at:89:507; Interrogation_Position=716; Antisense; GTGCCTCGAACAATCCTGATGTCTA

Paste this into a BLAST search page for me
TGCCCACTGCGTCAATGGCCAGAATGAATGCCAGTCGAATTAGCGTAGTTAGGGATCTCAACGATAGCTCCGGCTGCTTCCGATCGCAGGTGCAGTCGTAGGTGACTAGTGACATTGCCATCCTCACGAGAAGCGTGTGTCCACCATCGATAGGTGCCGATCAGGAGGTTCTCCTGGTTCTGTCTTCCACTTTGGCACAGTGGCACAGGTCCTTTCGCCAAATATAAATATCCCACTGTACTCCAGAAACGAGACGATGACCCAGCTGACGGACACCTATAAACAGGTGGGCGTCGTCTCATGGAACTGCATTCTGTGCCTCGAAGTGCCTCGAACAATCCTGATGTCTA

Full Affymetrix probeset data:

Annotations for 1629618_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720