FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629619_at:

>probe:Drosophila_2:1629619_at:285:465; Interrogation_Position=2125; Antisense; GATTGGCCAAGCTTAGGTTTCTTAC
>probe:Drosophila_2:1629619_at:529:187; Interrogation_Position=2218; Antisense; AACACTTGTGTTTACATGCGTCGAA
>probe:Drosophila_2:1629619_at:497:185; Interrogation_Position=2241; Antisense; AAAATACACTCTTTCATATGGGCTG
>probe:Drosophila_2:1629619_at:75:195; Interrogation_Position=2316; Antisense; AACTGAAGTTGTGGCGACGATCGTC
>probe:Drosophila_2:1629619_at:59:451; Interrogation_Position=2334; Antisense; GATCGTCGATCGCTGATCCCAGAGA
>probe:Drosophila_2:1629619_at:662:245; Interrogation_Position=2457; Antisense; AATTAAGCCGCTTTGTTTGCACAGC
>probe:Drosophila_2:1629619_at:567:215; Interrogation_Position=2513; Antisense; AAGTTGGTCCCCTATAGATCACCTG
>probe:Drosophila_2:1629619_at:175:455; Interrogation_Position=2529; Antisense; GATCACCTGTTGACACACGTACAAA
>probe:Drosophila_2:1629619_at:85:121; Interrogation_Position=2553; Antisense; AGCGGTGGCCTCTTAAACTAGACGA
>probe:Drosophila_2:1629619_at:407:677; Interrogation_Position=2571; Antisense; TAGACGAGATGTGGCCCTCATCAAC
>probe:Drosophila_2:1629619_at:197:33; Interrogation_Position=2590; Antisense; ATCAACCCCGGATGAGTAGTCACGT
>probe:Drosophila_2:1629619_at:166:91; Interrogation_Position=2604; Antisense; AGTAGTCACGTCTCGAATCGATGGA
>probe:Drosophila_2:1629619_at:529:609; Interrogation_Position=2636; Antisense; TGAGCCATTCATCACGATCGCCAGA
>probe:Drosophila_2:1629619_at:114:451; Interrogation_Position=2651; Antisense; GATCGCCAGAGTCGTCTCTAATGCA

Paste this into a BLAST search page for me
GATTGGCCAAGCTTAGGTTTCTTACAACACTTGTGTTTACATGCGTCGAAAAAATACACTCTTTCATATGGGCTGAACTGAAGTTGTGGCGACGATCGTCGATCGTCGATCGCTGATCCCAGAGAAATTAAGCCGCTTTGTTTGCACAGCAAGTTGGTCCCCTATAGATCACCTGGATCACCTGTTGACACACGTACAAAAGCGGTGGCCTCTTAAACTAGACGATAGACGAGATGTGGCCCTCATCAACATCAACCCCGGATGAGTAGTCACGTAGTAGTCACGTCTCGAATCGATGGATGAGCCATTCATCACGATCGCCAGAGATCGCCAGAGTCGTCTCTAATGCA

Full Affymetrix probeset data:

Annotations for 1629619_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720